Miyakogusa Predicted Gene

Lj3g3v3188580.4
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3188580.4 Non Chatacterized Hit- tr|I1KJX5|I1KJX5_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,63.24,6e-19,no
description,Homeodomain-like; Homeobox,Homeodomain;
Homeodomain-like,Homeodomain-like; Homeodomai,CUFF.45407.4
         (786 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW605972 homologue to UniRef100_Q8H1D2 Cluster: WUSCHEL...    72   6e-12
gnl|LJGI|TC57365 homologue to UniRef100_A7NU00 Cluster: Chromoso...    54   1e-06

>gnl|LJGI|BW605972 homologue to UniRef100_Q8H1D2 Cluster: WUSCHEL-related homeobox 5;
           n=1; Arabidopsis thaliana|Rep: WUSCHEL-related homeobox
           5 - Arabidopsis thaliana (Mouse-ear cress), partial
           (34%)
          Length = 448

 Score = 71.9 bits (36), Expect = 6e-12
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 229 aagaatgtgttctactggtttcagaatcataaggcaaggcagagacagaagc 280
           |||||||||||||| |||||||||||||| ||||| ||| ||||||||||||
Sbjct: 239 aagaatgtgttctattggtttcagaatcacaaggccagggagagacagaagc 290


>gnl|LJGI|TC57365 homologue to UniRef100_A7NU00 Cluster: Chromosome chr18 scaffold_1,
           whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_1, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (75%)
          Length = 1038

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 220 atcgaagggaagaatgtgttctactggtttcagaa 254
           |||||||||||||| |||||||| |||||||||||
Sbjct: 410 atcgaagggaagaacgtgttctattggtttcagaa 444