Miyakogusa Predicted Gene

Lj3g3v3177320.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3177320.1 CUFF.45394.1
         (333 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75735 homologue to UniRef100_A9RSQ3 Cluster: Predicte...    84   6e-16

>gnl|LJGI|TC75735 homologue to UniRef100_A9RSQ3 Cluster: Predicted protein; n=1;
           Physcomitrella patens subsp. patens|Rep: Predicted
           protein - Physcomitrella patens subsp. patens, partial
           (9%)
          Length = 933

 Score = 83.8 bits (42), Expect = 6e-16
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 272 gtctctttttgtccccttacaatttgttcatcgaagttattggaaataaccctcatttct 331
           ||||||||||||||||||||||| | | ||||||||||||| |||||| |||||||||||
Sbjct: 497 gtctctttttgtccccttacaatgtttacatcgaagttattagaaatagccctcatttct 556

             
Query: 332 aa 333
           ||
Sbjct: 557 aa 558