Miyakogusa Predicted Gene
- Lj3g3v3177320.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v3177320.1 CUFF.45394.1
(333 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75735 homologue to UniRef100_A9RSQ3 Cluster: Predicte... 84 6e-16
>gnl|LJGI|TC75735 homologue to UniRef100_A9RSQ3 Cluster: Predicted protein; n=1;
Physcomitrella patens subsp. patens|Rep: Predicted
protein - Physcomitrella patens subsp. patens, partial
(9%)
Length = 933
Score = 83.8 bits (42), Expect = 6e-16
Identities = 57/62 (91%)
Strand = Plus / Plus
Query: 272 gtctctttttgtccccttacaatttgttcatcgaagttattggaaataaccctcatttct 331
||||||||||||||||||||||| | | ||||||||||||| |||||| |||||||||||
Sbjct: 497 gtctctttttgtccccttacaatgtttacatcgaagttattagaaatagccctcatttct 556
Query: 332 aa 333
||
Sbjct: 557 aa 558