Miyakogusa Predicted Gene

Lj3g3v3166240.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3166240.1 Non Chatacterized Hit- tr|K4B294|K4B294_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,97.56,5e-16,UCH,Peptidase C19, ubiquitin carboxyl-terminal
hydrolase 2; Cysteine proteinases,NULL; UCH_2_1,Pepti,CUFF.45371.1
         (216 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78958 homologue to UniRef100_A7R3S3 Cluster: Ubiquiti...   234   2e-61
gnl|LJGI|TC62283 similar to UniRef100_A7R3S3 Cluster: Ubiquitin ...   186   4e-47

>gnl|LJGI|TC78958 homologue to UniRef100_A7R3S3 Cluster: Ubiquitin carboxyl-terminal
           hydrolase; n=1; Vitis vinifera|Rep: Ubiquitin
           carboxyl-terminal hydrolase - Vitis vinifera (Grape),
           partial (98%)
          Length = 1825

 Score =  234 bits (118), Expect = 2e-61
 Identities = 118/118 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggtgctacgggctccaagcttgagaaggctcttggcgaccaatttcctgaaggggaa 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351 atgggtgctacgggctccaagcttgagaaggctcttggcgaccaatttcctgaaggggaa 410

                                                                     
Query: 61  cgttactttggccttgagaatttcggcaacacttgttactgcaacagcgttttgcagg 118
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 cgttactttggccttgagaatttcggcaacacttgttactgcaacagcgttttgcagg 468


>gnl|LJGI|TC62283 similar to UniRef100_A7R3S3 Cluster: Ubiquitin carboxyl-terminal
           hydrolase; n=1; Vitis vinifera|Rep: Ubiquitin
           carboxyl-terminal hydrolase - Vitis vinifera (Grape),
           partial (48%)
          Length = 735

 Score =  186 bits (94), Expect = 4e-47
 Identities = 112/118 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggtgctacgggctccaagcttgagaaggctcttggcgaccaatttcctgaaggggaa 60
           ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||
Sbjct: 204 atgggtgctacgggctccaagcttgagaaggctcttggcgatcaattccctgaaggagaa 263

                                                                     
Query: 61  cgttactttggccttgagaatttcggcaacacttgttactgcaacagcgttttgcagg 118
           |||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 264 cgttacttcggccttgagaatttcggcaacacttgttattgcaacagtgttttgcagg 321