Miyakogusa Predicted Gene
- Lj3g3v3132890.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v3132890.1 Non Chatacterized Hit- tr|I1LR27|I1LR27_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,76.62,0,SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL; no description,NULL;
Malectin_like,Malectin-like ca,CUFF.45337.1
(1848 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AV418711 homologue to UniRef100_A7NZ90 Cluster: Chromos... 96 9e-19
gnl|LJGI|TC68661 similar to UniRef100_A7P1H0 Cluster: Chromosome... 58 2e-07
>gnl|LJGI|AV418711 homologue to UniRef100_A7NZ90 Cluster: Chromosome chr6 scaffold_3,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr6 scaffold_3, whole genome shotgun sequence
- Vitis vinifera (Grape), partial (37%)
Length = 419
Score = 95.6 bits (48), Expect = 9e-19
Identities = 93/108 (86%)
Strand = Plus / Plus
Query: 1738 aagagtcatttgtatggttcaggtctcccgagcttaagctggaaggagagacttgagata 1797
||||||||| | || ||||||||| ||||||||||||| ||||||||||||||||| |||
Sbjct: 9 aagagtcatctatacggttcaggtttcccgagcttaagttggaaggagagacttgacata 68
Query: 1798 tgcattggagtagcgagagtactgcattaccttcatactggttatgct 1845
||||||||| || |||| ||| |||||||| || ||||| ||||||
Sbjct: 69 tgcattggatctgctagaggacttcattacctacacactggctatgct 116
>gnl|LJGI|TC68661 similar to UniRef100_A7P1H0 Cluster: Chromosome chr19 scaffold_4,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr19 scaffold_4, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (23%)
Length = 895
Score = 58.0 bits (29), Expect = 2e-07
Identities = 74/89 (83%)
Strand = Plus / Plus
Query: 1600 caagggcttgctgagttccgaaccgaaattgaaatgctgtctcagttccgccaccgccat 1659
||||| |||||||| |||||||| ||||| |||||||| || || | ||||| ||||||
Sbjct: 236 caaggtcttgctgaattccgaacagaaatcgaaatgctatccaagcttcgccatcgccat 295
Query: 1660 ctggtatccttgattggctattgtgatga 1688
|| || || | |||||||||||||||||
Sbjct: 296 cttgtttctctcattggctattgtgatga 324