Miyakogusa Predicted Gene
- Lj3g3v3118700.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v3118700.1 Non Chatacterized Hit- tr|I1KDR3|I1KDR3_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.16337
PE,84.75,5e-19,Proteasom_PSMB,26S proteasome non-ATPase regulatory
subunit 5; 26S PROTEASOME NON-ATPASE REGULATORY ,CUFF.45329.1
(396 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP036976 similar to UniRef100_A7P1S2 Cluster: Chromosom... 194 3e-49
>gnl|LJGI|BP036976 similar to UniRef100_A7P1S2 Cluster: Chromosome chr19 scaffold_4,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr19 scaffold_4, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (7%)
Length = 290
Score = 194 bits (98), Expect = 3e-49
Identities = 170/185 (91%), Gaps = 13/185 (7%)
Strand = Plus / Minus
Query: 224 acatgccttttgttcaagtcggtctgcaggcaga---ttctcaagc-agtcagat---cc 276
||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||
Sbjct: 290 acatgccttttgttcaagtcggtctgcaggcagtaatttctcaagccagtcagaaatccc 231
Query: 277 ttag-cttgcaaaacagt-cact-tgccttc--tggataatct-tgataatgatcacaaa 330
|||| ||||||||||||| |||| ||||||| |||||||||| ||||||||||||||||
Sbjct: 230 ttaggcttgcaaaacagttcactctgccttcnntggataatctntgataatgatcacaaa 171
Query: 331 gttgctgctcatctaatagcggaattcaacatatatcctcttttgcttgattgccttatc 390
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 170 gttgctgctcatctaatagcggaattcaacatatatcctcttttgcttgattgccttatc 111
Query: 391 aaggg 395
|||||
Sbjct: 110 aaggg 106