Miyakogusa Predicted Gene

Lj3g3v3082350.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3082350.1 Non Chatacterized Hit- tr|I1LR57|I1LR57_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.54458
PE,55.07,0,HOMEOBOX PROTEIN KNOTTED-1-RELATED,NULL; HOMEOBOX PROTEIN
TRANSCRIPTION FACTORS,NULL; no description,CUFF.45227.1
         (2271 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO010290 similar to UniRef100_Q9SIW1 Cluster: BEL1-like...    54   4e-06
gnl|LJGI|TC79072 similar to UniRef100_Q2PF41 Cluster: BEL1-like ...    54   4e-06
gnl|LJGI|TC64160 similar to UniRef100_Q2PF41 Cluster: BEL1-like ...    54   4e-06

>gnl|LJGI|GO010290 similar to UniRef100_Q9SIW1 Cluster: BEL1-like homeodomain protein 7;
            n=1; Arabidopsis thaliana|Rep: BEL1-like homeodomain
            protein 7 - Arabidopsis thaliana (Mouse-ear cress),
            partial (20%)
          Length = 695

 Score = 54.0 bits (27), Expect = 4e-06
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1715 gaaaccaggtttcaaattggttcattaatgctcgagtccgagtgtggaagccaatggttg 1774
            ||||||||||  |||||||||||||||||||  | || ||  | ||||||||||||||||
Sbjct: 212  gaaaccaggtggcaaattggttcattaatgcaagggtgcgtctttggaagccaatggttg 271

                   
Query: 1775 aggaaat 1781
            | |||||
Sbjct: 272  aagaaat 278


>gnl|LJGI|TC79072 similar to UniRef100_Q2PF41 Cluster: BEL1-like homeodomain
            transcription factor; n=1; Trifolium pratense|Rep:
            BEL1-like homeodomain transcription factor - Trifolium
            pratense (Red clover), partial (15%)
          Length = 599

 Score = 54.0 bits (27), Expect = 4e-06
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1719 ccaggtttcaaattggttcattaatgctcgagtccgagtgtggaagccaatggttgagga 1778
            ||||||||||||||||||||| || |||||||| ||  | |||||||| ||||| || ||
Sbjct: 182  ccaggtttcaaattggttcataaacgctcgagttcggctatggaagcctatggtggaaga 241

               
Query: 1779 aat 1781
            |||
Sbjct: 242  aat 244


>gnl|LJGI|TC64160 similar to UniRef100_Q2PF41 Cluster: BEL1-like homeodomain
            transcription factor; n=1; Trifolium pratense|Rep:
            BEL1-like homeodomain transcription factor - Trifolium
            pratense (Red clover), partial (46%)
          Length = 1585

 Score = 54.0 bits (27), Expect = 4e-06
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1719 ccaggtttcaaattggttcattaatgctcgagtccgagtgtggaagccaatggttgagga 1778
            ||||||||||||||||||||| || |||||||| ||  | |||||||| ||||| || ||
Sbjct: 1408 ccaggtttcaaattggttcataaacgctcgagttcggctatggaagcctatggtggaaga 1467

               
Query: 1779 aat 1781
            |||
Sbjct: 1468 aat 1470