Miyakogusa Predicted Gene

Lj3g3v2983960.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2983960.1 Non Chatacterized Hit- tr|A5CBC0|A5CBC0_VITVI
Putative uncharacterized protein OS=Vitis vinifera GN=,33,5e-16,L
domain-like,NULL; no description,NULL; LRR_7,NULL; LRR_1,Leucine-rich
repeat,CUFF.45058.1
         (1074 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW595042 weakly similar to UniRef100_A2Q529 Cluster: Le...   101   9e-21

>gnl|LJGI|BW595042 weakly similar to UniRef100_A2Q529 Cluster: Leucine-rich repeat;
           n=1; Medicago truncatula|Rep: Leucine-rich repeat -
           Medicago truncatula (Barrel medic), partial (19%)
          Length = 486

 Score =  101 bits (51), Expect = 9e-21
 Identities = 96/111 (86%)
 Strand = Plus / Plus

                                                                       
Query: 477 tttagtatcattggcaatagaaggattggctgtgcccaacttgactagcttcaccatttc 536
           ||||||||||||||||| |||||||||||| |  |||||||||| |   ||| || ||||
Sbjct: 348 tttagtatcattggcaagagaaggattggcggctcccaacttgattgaattctccgtttc 407

                                                              
Query: 537 cttttgcgacaagttaaagtcattgcctcgtcggatggatactcttctccc 587
              ||||||||||||| |||||||||||||||||||| |||||||||||||
Sbjct: 408 tgattgcgacaagttagagtcattgcctcgtcggatgaatactcttctccc 458