Miyakogusa Predicted Gene

Lj3g3v2949670.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2949670.2 tr|G7JH96|G7JH96_MEDTR Transcription factor E2F
OS=Medicago truncatula GN=MTR_4g052000 PE=3 SV=1,79.53,0,E2F-DP
heterodimerization region,NULL; "Winged helix" DNA-binding
domain,NULL; seg,NULL; no descript,CUFF.45032.2
         (885 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS340221 similar to UniRef100_Q9C5B5 Cluster: E2F-4 pro...    60   2e-08

>gnl|LJGI|FS340221 similar to UniRef100_Q9C5B5 Cluster: E2F-4 protein; n=1;
           Arabidopsis thaliana|Rep: E2F-4 protein - Arabidopsis
           thaliana (Mouse-ear cress), partial (13%)
          Length = 720

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 405 tcgttacgacagctctttgggtctgttgacaaagaagttcatcaatttgatcaaacaagc 464
           |||||| ||||| || || ||||| |||||||  ||||| |||| ||||||||| || ||
Sbjct: 635 tcgttatgacagttccttaggtcttttgacaagaaagtttatcattttgatcaagcatgc 694

                             
Query: 465 agaggatggtatgcttga 482
           ||||||||| ||||||||
Sbjct: 695 agaggatggaatgcttga 712