Miyakogusa Predicted Gene
- Lj3g3v2921060.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v2921060.1 tr|Q6IEN8|Q6IEN8_ORYSI WRKY transcription factor
43 OS=Oryza sativa subsp. indica GN=WRKY43 PE=4
SV=,38.17,0.00000000000003,WRKY,DNA-binding WRKY; WRKY DNA-binding
domain,DNA-binding WRKY; DNA binding domain,DNA-binding
WRKY,CUFF.44981.1
(1743 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC78623 homologue to UniRef100_A7LHH6 Cluster: WRKY36; ... 523 e-147
gnl|LJGI|GO036133 similar to UniRef100_A7LHH6 Cluster: WRKY36; n... 278 1e-73
gnl|LJGI|FS323546 similar to UniRef100_Q2HT21 Cluster: DNA-bindi... 135 1e-30
gnl|LJGI|TC59629 similar to UniRef100_A7QUJ4 Cluster: Chromosome... 119 6e-26
gnl|LJGI|TC58147 similar to UniRef100_A7LHG6 Cluster: WRKY23; n=... 115 1e-24
gnl|LJGI|FS338285 similar to UniRef100_A7PMP4 Cluster: Chromosom... 82 1e-14
gnl|LJGI|TC67736 similar to UniRef100_A7PMP4 Cluster: Chromosome... 56 8e-07
>gnl|LJGI|TC78623 homologue to UniRef100_A7LHH6 Cluster: WRKY36; n=1; Glycine max|Rep:
WRKY36 - Glycine max (Soybean), partial (73%)
Length = 1098
Score = 523 bits (264), Expect = e-147
Identities = 390/432 (90%)
Strand = Plus / Plus
Query: 907 aatgttgatcaggctgaggctaccatgaggaaggctagagtttctgttagagctcgatca 966
||||||||||| ||||| || |||||||| ||||| |||||||| |||||||||||||||
Sbjct: 46 aatgttgatcaagctgaagccaccatgagaaaggcaagagtttcggttagagctcgatca 105
Query: 967 gaggcacccatgatcactgatgggtgtcaatggagaaagtatgggcagaagatggccaaa 1026
|||||| | ||| ||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 106 gaggcatctatgctcactgatgggtgtcaatggagaaagtatgggcagaaaatggccaaa 165
Query: 1027 ggaaatccatgtcctcgagcttattatcgatgcaccatggctgctggttgcccagttaga 1086
||||| ||||||||| |||||||||| |||||||||||||||||||||||||||| |||
Sbjct: 166 ggaaacccatgtcctagagcttattacagatgcaccatggctgctggttgcccagtcaga 225
Query: 1087 aaacaggtgcaaagatgtgctgaagacaaaacagtcctcatcacaacctatgaaggcaac 1146
|||||||| ||||| ||||||||||||| |||| | || |||||||| |||||||| |||
Sbjct: 226 aaacaggtacaaaggtgtgctgaagacagaacaatactgatcacaacatatgaaggaaac 285
Query: 1147 cacaaccaccctctccctccagcagcaatggcaatggcacagaccacttcctcagctgca 1206
||||| |||||||| |||||||||||||||||||||||||| || |||||||||||||||
Sbjct: 286 cacaaacaccctctgcctccagcagcaatggcaatggcacaaacaacttcctcagctgca 345
Query: 1207 agaatgcttctttcagggtcaatgtcaagcactgacaaccttatgaatgcaaacttcctg 1266
|||||||| |||||||| ||||||||||| |||| ||| |||||||||||||||||
Sbjct: 346 agaatgctgctttcaggatcaatgtcaagtgctgatggcctgatgaatgcaaacttcctc 405
Query: 1267 acaaggacactccttccatgctcttccagcatggcaacaatctcagcctcagctccattc 1326
||||||||||||||||| ||||| || |||||||||||||| ||||| ||||||||||||
Sbjct: 406 acaaggacactccttccttgctcctcaagcatggcaacaatttcagcatcagctccattc 465
Query: 1327 ccaacagtcaca 1338
||||| ||||||
Sbjct: 466 ccaactgtcaca 477
Score = 83.8 bits (42), Expect = 3e-15
Identities = 60/66 (90%)
Strand = Plus / Plus
Query: 1569 tgctgccattgctactgacccaaatttcactgcagctttagcagcagctatcacttccat 1628
||||||||||||| |||| || ||||||||||||||||| ||||| || |||||||||||
Sbjct: 720 tgctgccattgctgctgatcccaatttcactgcagctttggcagccgccatcacttccat 779
Query: 1629 tattgg 1634
||||||
Sbjct: 780 tattgg 785
>gnl|LJGI|GO036133 similar to UniRef100_A7LHH6 Cluster: WRKY36; n=1; Glycine max|Rep:
WRKY36 - Glycine max (Soybean), partial (33%)
Length = 647
Score = 278 bits (140), Expect = 1e-73
Identities = 191/208 (91%)
Strand = Plus / Plus
Query: 907 aatgttgatcaggctgaggctaccatgaggaaggctagagtttctgttagagctcgatca 966
||||||||||| ||||| || |||||||| ||||| |||||||| |||||||||||||||
Sbjct: 397 aatgttgatcaagctgaagccaccatgagaaaggcaagagtttcggttagagctcgatca 456
Query: 967 gaggcacccatgatcactgatgggtgtcaatggagaaagtatgggcagaagatggccaaa 1026
|||||| | ||| ||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 457 gaggcatctatgctcactgatgggtgtcaatggagaaagtatgggcagaaaatggccaaa 516
Query: 1027 ggaaatccatgtcctcgagcttattatcgatgcaccatggctgctggttgcccagttaga 1086
||||| ||||||||| |||||||||| |||||||||||||||||||||||||||| |||
Sbjct: 517 ggaaacccatgtcctagagcttattacagatgcaccatggctgctggttgcccagtcaga 576
Query: 1087 aaacaggtgcaaagatgtgctgaagaca 1114
|||||||| ||||| |||||||||||||
Sbjct: 577 aaacaggtacaaaggtgtgctgaagaca 604
Score = 159 bits (80), Expect = 7e-38
Identities = 125/140 (89%)
Strand = Plus / Plus
Query: 1170 agcaatggcaatggcacagaccacttcctcagctgcaagaatgcttctttcagggtcaat 1229
|||||||||||||||||| || ||||||||||||||||||||||| |||||||| |||||
Sbjct: 2 agcaatggcaatggcacaaacaacttcctcagctgcaagaatgctgctttcaggatcaat 61
Query: 1230 gtcaagcactgacaaccttatgaatgcaaacttcctgacaaggacactccttccatgctc 1289
|||||| |||| ||| ||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 62 gtcaagtgctgatggcctgatgaatgcaaacttcctcacaaggacactccttccttgctc 121
Query: 1290 ttccagcatggcaacaatct 1309
|| ||||||| ||||||||
Sbjct: 122 ctcaagcatggaaacaatct 141
>gnl|LJGI|FS323546 similar to UniRef100_Q2HT21 Cluster: DNA-binding WRKY; n=2;
Medicago truncatula|Rep: DNA-binding WRKY - Medicago
truncatula (Barrel medic), partial (15%)
Length = 727
Score = 135 bits (68), Expect = 1e-30
Identities = 214/265 (80%), Gaps = 12/265 (4%)
Strand = Plus / Plus
Query: 320 ctttgttggaattcaaagtaaacactggtctgaatcttctcactaccaacactagcagtg 379
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 340 ctttgttagaattcaaagtaaacactggtctgaatcttctcaccaccaacactagcagtg 399
Query: 380 atcaatccatggtggacgatggcaatggcaatggcatatcacctaattcagatgacaaaa 439
|||| |||||||| || | ||| |||| || | |||| || |||||||
Sbjct: 400 atcagtccatggttgagg------------atgacataccatccaatttggaagacaaaa 447
Query: 440 gaactaaaaatgagttggctgttcttcaagctgagctagagcgaatgaaggtggagaatc 499
|| |||| | ||| ||| |||||||||||||||| | |||||| |||||||||||||||
Sbjct: 448 gagctaagatggagctggttgttcttcaagctgagattgagcgagtgaaggtggagaatc 507
Query: 500 accggttaaagaacacgcttgaggagatgaataccaattacaatgccctgcagatgcatt 559
| || | || || |||||| || |||| ||||||||||||| |||| | ||||||
Sbjct: 508 atcgcctgcggagcatgcttgaacaggtgaacaccaattacaatgagctgcgggtgcatt 567
Query: 560 tggtgagcatgatgcaggaccagaa 584
|||||||| ||||||||| ||||||
Sbjct: 568 tggtgagcttgatgcagggccagaa 592
>gnl|LJGI|TC59629 similar to UniRef100_A7QUJ4 Cluster: Chromosome chr10 scaffold_179,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr10 scaffold_179, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (39%)
Length = 1579
Score = 119 bits (60), Expect = 6e-26
Identities = 111/128 (86%)
Strand = Plus / Plus
Query: 985 gatgggtgtcaatggagaaagtatgggcagaagatggccaaaggaaatccatgtcctcga 1044
||||| |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 757 gatggatgtcaatggagaaagtatgggcagaagatggcaaaagggaatccttgtcctcga 816
Query: 1045 gcttattatcgatgcaccatggctgctggttgcccagttagaaaacaggtgcaaagatgt 1104
||||||||||| ||||| || | ||| ||| |||||| | ||||| || ||||| |||
Sbjct: 817 gcttattatcgttgcacaatcgggactgcttgtccagttcgtaaacaagtacaaaggtgt 876
Query: 1105 gctgaaga 1112
||||||||
Sbjct: 877 gctgaaga 884
>gnl|LJGI|TC58147 similar to UniRef100_A7LHG6 Cluster: WRKY23; n=1; Glycine max|Rep:
WRKY23 - Glycine max (Soybean), partial (61%)
Length = 2162
Score = 115 bits (58), Expect = 1e-24
Identities = 109/126 (86%)
Strand = Plus / Plus
Query: 958 gctcgatcagaggcacccatgatcactgatgggtgtcaatggagaaagtatgggcagaag 1017
||||||||||| || ||||||||| |||||| || |||||| |||||||||| || ||
Sbjct: 1022 gctcgatcagaagcttccatgatcagtgatggatgccaatggcgaaagtatggacaaaaa 1081
Query: 1018 atggccaaaggaaatccatgtcctcgagcttattatcgatgcaccatggctgctggttgc 1077
||||| ||||||||||||||||||||||| ||||| ||||||||||||| | ||||||
Sbjct: 1082 atggcaaaaggaaatccatgtcctcgagcatattacagatgcaccatggcagttggttgt 1141
Query: 1078 ccagtt 1083
||||||
Sbjct: 1142 ccagtt 1147
Score = 56.0 bits (28), Expect = 8e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 1294 agcatggcaacaatctcagcctcagctccattcccaacagtcacacttgacctcac 1349
|||||||||||| | ||||| ||||| |||||||| || || ||||||||||||||
Sbjct: 1476 agcatggcaacactttcagcttcagcaccattccctaccgtgacacttgacctcac 1531
>gnl|LJGI|FS338285 similar to UniRef100_A7PMP4 Cluster: Chromosome chr14 scaffold_21,
whole genome shotgun sequence; n=2; core
eudicotyledons|Rep: Chromosome chr14 scaffold_21, whole
genome shotgun sequence - Vitis vinifera (Grape), partial
(23%)
Length = 848
Score = 81.8 bits (41), Expect = 1e-14
Identities = 107/129 (82%)
Strand = Plus / Plus
Query: 984 tgatgggtgtcaatggagaaagtatgggcagaagatggccaaaggaaatccatgtcctcg 1043
||||||||| ||||||||||| ||||| || || || || ||||||||||||||||| ||
Sbjct: 610 tgatgggtgccaatggagaaaatatggacaaaaaatagcaaaaggaaatccatgtccccg 669
Query: 1044 agcttattatcgatgcaccatggctgctggttgcccagttagaaaacaggtgcaaagatg 1103
||||| ||||||||||| | || | ||| || || |||||||||||||| |||||
Sbjct: 670 tgcttactatcgatgcactgtctctccaacttgtcctgtgagaaaacaggtgcagagatg 729
Query: 1104 tgctgaaga 1112
|||||||||
Sbjct: 730 tgctgaaga 738
>gnl|LJGI|TC67736 similar to UniRef100_A7PMP4 Cluster: Chromosome chr14 scaffold_21,
whole genome shotgun sequence; n=2; core
eudicotyledons|Rep: Chromosome chr14 scaffold_21, whole
genome shotgun sequence - Vitis vinifera (Grape), partial
(18%)
Length = 742
Score = 56.0 bits (28), Expect = 8e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 984 tgatgggtgtcaatggagaaagtatgggcagaagatggccaaaggaaatccatgtc 1039
|||||| || || |||||||| ||||| |||||||| || ||||||||||||||||
Sbjct: 687 tgatggatgccagtggagaaaatatggacagaagatagcaaaaggaaatccatgtc 742