Miyakogusa Predicted Gene

Lj3g3v2888310.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2888310.1 Non Chatacterized Hit- tr|I1KF92|I1KF92_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.40201
PE,55.73,2e-17,seg,NULL,CUFF.44881.1
         (348 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS344465                                                      72   2e-12

>gnl|LJGI|FS344465 
          Length = 629

 Score = 71.9 bits (36), Expect = 2e-12
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 226 aagcaccattcaatagacaagtcagaggctggtgggggtgtcatcattggtggatttgtt 285
           ||||| ||||| | |||||| |||| ||||||||| ||||| ||| | |||||  |||||
Sbjct: 350 aagcatcattccacagacaaatcagtggctggtggtggtgtgatcctaggtggccttgtt 409

                                                               
Query: 286 actgctatatttgctgctgtttttgcctacattcgtgttaccaggaaaaggg 337
           |||||||  |||||| |||| |||  ||||||||| || |||||||||||||
Sbjct: 410 actgctacttttgctactgtcttttgctacattcgggtcaccaggaaaaggg 461