Miyakogusa Predicted Gene

Lj3g3v2887090.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2887090.1 Non Chatacterized Hit- tr|I1KE70|I1KE70_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,64.43,0,OS07G0550500 PROTEIN,NULL; UNCHARACTERIZED,NULL;
EGF_3,Epidermal growth factor-like domain; BULB_LEC,CUFF.44876.1
         (1306 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW594516 weakly similar to UniRef100_A7P197 Cluster: Ch...    54   2e-06

>gnl|LJGI|BW594516 weakly similar to UniRef100_A7P197 Cluster: Chromosome chr19
           scaffold_4, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr19 scaffold_4, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (17%)
          Length = 486

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 452 ttttgtggcagagttttgattatcctagtgatacattgatgtcgggaatgaagcttgggt 511
           |||||||||||||||||||||||||   ||| |||||| |  | |||||||||||||| |
Sbjct: 282 ttttgtggcagagttttgattatccatctgacacattgctaccaggaatgaagcttggtt 341

                  
Query: 512 ggaactt 518
           | |||||
Sbjct: 342 gtaactt 348