Miyakogusa Predicted Gene
- Lj3g3v2873590.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v2873590.1 Non Chatacterized Hit- tr|I1KF65|I1KF65_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,84.89,0,NADH
DEHYDROGENASE-RELATED,NULL; FAD/NAD(P)-binding domain,NULL;
Pyr_redox_2,Pyridine nucleotide-dis,CUFF.44829.1
(426 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC63897 similar to UniRef100_Q2HTY1 Cluster: FAD-depend... 58 5e-08
>gnl|LJGI|TC63897 similar to UniRef100_Q2HTY1 Cluster: FAD-dependent pyridine
nucleotide-disulphide oxidoreductase; Calcium- binding
EF-hand; n=1; Medicago truncatula|Rep: FAD-dependent
pyridine nucleotide-disulphide oxidoreductase; Calcium-
binding EF-hand - Medicago truncatula (Barrel medic),
partial (97%)
Length = 2171
Score = 58.0 bits (29), Expect = 5e-08
Identities = 62/73 (84%)
Strand = Plus / Plus
Query: 23 ttcatgtggtttcaccacgtaactattttgcattcactcctctgctaccaagcgtcactt 82
|||||||||| || || || ||||||||||| ||||||||| |||| |||||||| || |
Sbjct: 391 ttcatgtggtgtcgcctcgcaactattttgccttcactcctttgctgccaagcgttacct 450
Query: 83 gtggcacagtgga 95
|||| || |||||
Sbjct: 451 gtggaactgtgga 463