Miyakogusa Predicted Gene

Lj3g3v2848780.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2848780.1 tr|Q5KH02|Q5KH02_CRYNJ Expressed protein
OS=Cryptococcus neoformans var. neoformans serotype D
(stra,35.42,7.1,seg,NULL,CUFF.44787.1
         (201 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81840 weakly similar to UniRef100_Q2JSH5 Cluster: Pro...    70   5e-12

>gnl|LJGI|TC81840 weakly similar to UniRef100_Q2JSH5 Cluster: Protein kinase; n=1;
          Synechococcus sp. JA-3-3Ab|Rep: Protein kinase -
          Synechococcus sp. (strain JA-3-3Ab) (Cyanobacteria
          bacteriumYellowstone A-Prime), partial (5%)
          Length = 1128

 Score = 69.9 bits (35), Expect = 5e-12
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                             
Query: 36 caccccgtcgttcatctttcatcaccatctctgca 70
          |||||||||||||||||||||||||||||||||||
Sbjct: 2  caccccgtcgttcatctttcatcaccatctctgca 36