Miyakogusa Predicted Gene

Lj3g3v2745080.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2745080.1 tr|F3JUJ3|F3JUJ3_PSESZ Outer membrane
autotransporter barrel OS=Pseudomonas syringae pv. tabaci
str.,28.74,8.8, ,CUFF.44584.1
         (319 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW607615 similar to UniRef100_Q4JEZ5 Cluster: Sialyltra...    56   1e-07

>gnl|LJGI|BW607615 similar to UniRef100_Q4JEZ5 Cluster: Sialyltransferase-like
           protein; n=1; Gossypium raimondii|Rep:
           Sialyltransferase-like protein - Gossypium raimondii
           (New World cotton), partial (11%)
          Length = 461

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 145 gtgatttggggaagaggagaaggtcgtgatttgagccgaaggtggttggctgaggt 200
           ||||| |||||||||||||||||||| |||||| |  | |||||||||| ||||||
Sbjct: 413 gtgatatggggaagaggagaaggtcgcgatttgggttggaggtggttgggtgaggt 358