Miyakogusa Predicted Gene

Lj3g3v2738610.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2738610.1 Non Chatacterized Hit- tr|I1J7V2|I1J7V2_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,84.09,0.0000000001,gcp_kae1: metallohydrolase, glycoprotease/Kae1
fam,Kae1/YgjD family; OSIALOPTASE,Kae1/YgjD family; S,CUFF.44577.1
         (1044 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW611875 similar to UniRef100_A7PYD9 Cluster: Chromosom...   182   3e-45

>gnl|LJGI|BW611875 similar to UniRef100_A7PYD9 Cluster: Chromosome chr15 scaffold_37,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr15 scaffold_37, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (16%)
          Length = 486

 Score =  182 bits (92), Expect = 3e-45
 Identities = 92/92 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcagaagaagctcactctcaagtgatagaccaggttgtgcaagaagcccttgataaa 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 atggcagaagaagctcactctcaagtgatagaccaggttgtgcaagaagcccttgataaa 454

                                           
Query: 61  gcttatatgactgagaaggatctcagtgcagt 92
           ||||||||||||||||||||||||||||||||
Sbjct: 455 gcttatatgactgagaaggatctcagtgcagt 486