Miyakogusa Predicted Gene
- Lj3g3v2738610.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v2738610.1 Non Chatacterized Hit- tr|I1J7V2|I1J7V2_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,84.09,0.0000000001,gcp_kae1: metallohydrolase, glycoprotease/Kae1
fam,Kae1/YgjD family; OSIALOPTASE,Kae1/YgjD family; S,CUFF.44577.1
(1044 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BW611875 similar to UniRef100_A7PYD9 Cluster: Chromosom... 182 3e-45
>gnl|LJGI|BW611875 similar to UniRef100_A7PYD9 Cluster: Chromosome chr15 scaffold_37,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr15 scaffold_37, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (16%)
Length = 486
Score = 182 bits (92), Expect = 3e-45
Identities = 92/92 (100%)
Strand = Plus / Plus
Query: 1 atggcagaagaagctcactctcaagtgatagaccaggttgtgcaagaagcccttgataaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 atggcagaagaagctcactctcaagtgatagaccaggttgtgcaagaagcccttgataaa 454
Query: 61 gcttatatgactgagaaggatctcagtgcagt 92
||||||||||||||||||||||||||||||||
Sbjct: 455 gcttatatgactgagaaggatctcagtgcagt 486