Miyakogusa Predicted Gene

Lj3g3v2737600.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2737600.1 Non Chatacterized Hit- tr|E1ZST9|E1ZST9_CHLVA
Putative uncharacterized protein OS=Chlorella
variabil,50,1e-16,S-adenosyl-L-methionine-dependent
methyltransferases,NULL; Methyltransf_31,NULL;
N6-DNA-METHYLTRANSF,CUFF.44569.1
         (333 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW632910 similar to UniRef100_Q2HS71 Cluster: SAM (And ...   327   2e-89
gnl|LJGI|FS315936 weakly similar to UniRef100_Q2HS71 Cluster: SA...   141   3e-33

>gnl|LJGI|BW632910 similar to UniRef100_Q2HS71 Cluster: SAM (And some other
           nucleotide) binding motif; Methyltransferase small;
           Tetratricopeptide-like helical; n=1; Medicago
           truncatula|Rep: SAM (And some other nucleotide) binding
           motif; Methyltransferase small; Tetratricopeptide-like
           helical - Medicago truncatula (Barrel medic), partial
           (8%)
          Length = 515

 Score =  327 bits (165), Expect = 2e-89
 Identities = 165/165 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcttcgagaaaggagttatctagaactgctcaaattcgccttgtgagttcacatgag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351 atggcttcgagaaaggagttatctagaactgctcaaattcgccttgtgagttcacatgag 410

                                                                       
Query: 61  gaggtttatgaaccgtgtgatgattcttttgcgctggttgatgctcttctagctgatcgc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 gaggtttatgaaccgtgtgatgattcttttgcgctggttgatgctcttctagctgatcgc 470

                                                        
Query: 121 actaaccttttggaacatcatccagcattgtgtatggagataggc 165
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 471 actaaccttttggaacatcatccagcattgtgtatggagataggc 515


>gnl|LJGI|FS315936 weakly similar to UniRef100_Q2HS71 Cluster: SAM (And some other
           nucleotide) binding motif; Methyltransferase small;
           Tetratricopeptide-like helical; n=1; Medicago
           truncatula|Rep: SAM (And some other nucleotide) binding
           motif; Methyltransferase small; Tetratricopeptide-like
           helical - Medicago truncatula (Barrel medic), partial
           (5%)
          Length = 475

 Score =  141 bits (71), Expect = 3e-33
 Identities = 71/71 (100%)
 Strand = Plus / Plus

                                                                       
Query: 3   ggcttcgagaaaggagttatctagaactgctcaaattcgccttgtgagttcacatgagga 62
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 405 ggcttcgagaaaggagttatctagaactgctcaaattcgccttgtgagttcacatgagga 464

                      
Query: 63  ggtttatgaac 73
           |||||||||||
Sbjct: 465 ggtttatgaac 475