Miyakogusa Predicted Gene

Lj3g3v2735140.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2735140.1 Non Chatacterized Hit- tr|I1JKM0|I1JKM0_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,89.46,0,PLANT
SEC1,NULL; VESICLE PROTEIN SORTING-ASSOCIATED,Sec1-like protein;
Sec1,Sec1-like protein; no de,CUFF.44531.1
         (1305 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64134 similar to UniRef100_Q9C5X3 Cluster: SNARE-inte...    86   6e-16
gnl|LJGI|TC75825 similar to UniRef100_A7PHY4 Cluster: Chromosome...    58   1e-07
gnl|LJGI|TC80561 similar to UniRef100_Q9C5X3 Cluster: SNARE-inte...    54   2e-06

>gnl|LJGI|TC64134 similar to UniRef100_Q9C5X3 Cluster: SNARE-interacting protein
           KEULE; n=1; Arabidopsis thaliana|Rep: SNARE-interacting
           protein KEULE - Arabidopsis thaliana (Mouse-ear cress),
           partial (35%)
          Length = 812

 Score = 85.7 bits (43), Expect = 6e-16
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaaggcaaccattaccatctatggatgctgtttatttcatccagccttcaaaagagaatg 301
           ||||||| ||||| ||| | ||||||||||| ||||||||||||||  | ||||||||||
Sbjct: 329 gaaggcagccatttccaaccatggatgctgtatatttcatccagccaaccaaagagaatg 388

                                                                       
Query: 302 tggtcatgttcttgtctgatatgtctggaagggagcccctatacaggaaagcctatgtat 361
           | || ||||| ||||| || |||||||||| ||  ||| |||||||||| || | ||| |
Sbjct: 389 tagttatgtttttgtcagacatgtctggaaaggctcccttatacaggaaggcatttgttt 448

                      
Query: 362 ttttcagttca 372
           | |||||||||
Sbjct: 449 tcttcagttca 459


>gnl|LJGI|TC75825 similar to UniRef100_A7PHY4 Cluster: Chromosome chr13 scaffold_17,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr13 scaffold_17, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (34%)
          Length = 1015

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 262 atggatgctgtttatttcatccagccttcaaaagagaatgtggtcatgttcttgtctgat 321
           ||||||||| | || |||||||||||  ||||||||||| |  | ||||| ||||| || 
Sbjct: 547 atggatgctatatacttcatccagccaacaaaagagaatatcataatgtttttgtcagac 606

                                        
Query: 322 atgtctggaagggagcccctatacaggaa 350
           |||||||||||| ||||| ||||| ||||
Sbjct: 607 atgtctggaaggaagcccttataccggaa 635


>gnl|LJGI|TC80561 similar to UniRef100_Q9C5X3 Cluster: SNARE-interacting protein KEULE;
            n=1; Arabidopsis thaliana|Rep: SNARE-interacting protein
            KEULE - Arabidopsis thaliana (Mouse-ear cress), partial
            (40%)
          Length = 1091

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 1195 cttcgagagcttggacagttggagcaagatcttgttttcggggatgctgga 1245
            ||||| || ||||| ||| ||||||||||||||||||| || |||||||||
Sbjct: 72   cttcgggaacttgggcagctggagcaagatcttgtttttggagatgctgga 122