Miyakogusa Predicted Gene

Lj3g3v2692930.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2692930.1 Non Chatacterized Hit- tr|B9RIH0|B9RIH0_RICCO
Leucine-rich repeat containing protein, putative
OS=Ri,27.78,6e-16,DISEASERSIST,Disease resistance protein; P-loop
containing nucleoside triphosphate hydrolases,NULL; ,CUFF.44400.1
         (2748 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82729 weakly similar to UniRef100_A7JIT6 Cluster: Pre...    94   6e-18
gnl|LJGI|FS333816 weakly similar to UniRef100_A2Q1X9 Cluster: TI...    66   1e-09

>gnl|LJGI|TC82729 weakly similar to UniRef100_A7JIT6 Cluster: Predicted protein; n=1;
            Francisella tularensis subsp. novicida GA99-3549|Rep:
            Predicted protein - Francisella tularensis subsp.
            novicida GA99-3549, partial (4%)
          Length = 892

 Score = 93.7 bits (47), Expect = 6e-18
 Identities = 56/59 (94%)
 Strand = Plus / Plus

                                                                       
Query: 2332 tcagatcatgtgtttttatggtatgatgcacaatgttgccagaagataatggaagcaat 2390
            |||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||
Sbjct: 30   tcagatcatgtgtttttatggtatgatgcaaaatgttgccagcagataagggaagcaat 88


>gnl|LJGI|FS333816 weakly similar to UniRef100_A2Q1X9 Cluster: TIR; n=1; Medicago
            truncatula|Rep: TIR - Medicago truncatula (Barrel medic),
            partial (13%)
          Length = 582

 Score = 65.9 bits (33), Expect = 1e-09
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                        
Query: 938  aaatgcatgacttgatacaagcaatgggtagggaaattgttcgtaaagaatctcctaaag 997
            |||||||||||||| |||||| ||||||  |||||||||||| | ||||||||   || |
Sbjct: 193  aaatgcatgacttgttacaagaaatgggatgggaaattgttcatcaagaatctatcaagg 252

                                                             
Query: 998  atcctggacaacgcagcagattgtgggatcctgaggaagtttgtgatgt 1046
            ||||||||  ||| ||  |||| |||||||| |||||||| | ||||||
Sbjct: 253  atcctggaagacgaagtcgattatgggatccagaggaagtgtatgatgt 301