Miyakogusa Predicted Gene
- Lj3g3v2692930.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v2692930.1 Non Chatacterized Hit- tr|B9RIH0|B9RIH0_RICCO
Leucine-rich repeat containing protein, putative
OS=Ri,27.78,6e-16,DISEASERSIST,Disease resistance protein; P-loop
containing nucleoside triphosphate hydrolases,NULL; ,CUFF.44400.1
(2748 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC82729 weakly similar to UniRef100_A7JIT6 Cluster: Pre... 94 6e-18
gnl|LJGI|FS333816 weakly similar to UniRef100_A2Q1X9 Cluster: TI... 66 1e-09
>gnl|LJGI|TC82729 weakly similar to UniRef100_A7JIT6 Cluster: Predicted protein; n=1;
Francisella tularensis subsp. novicida GA99-3549|Rep:
Predicted protein - Francisella tularensis subsp.
novicida GA99-3549, partial (4%)
Length = 892
Score = 93.7 bits (47), Expect = 6e-18
Identities = 56/59 (94%)
Strand = Plus / Plus
Query: 2332 tcagatcatgtgtttttatggtatgatgcacaatgttgccagaagataatggaagcaat 2390
|||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||
Sbjct: 30 tcagatcatgtgtttttatggtatgatgcaaaatgttgccagcagataagggaagcaat 88
>gnl|LJGI|FS333816 weakly similar to UniRef100_A2Q1X9 Cluster: TIR; n=1; Medicago
truncatula|Rep: TIR - Medicago truncatula (Barrel medic),
partial (13%)
Length = 582
Score = 65.9 bits (33), Expect = 1e-09
Identities = 90/109 (82%)
Strand = Plus / Plus
Query: 938 aaatgcatgacttgatacaagcaatgggtagggaaattgttcgtaaagaatctcctaaag 997
|||||||||||||| |||||| |||||| |||||||||||| | |||||||| || |
Sbjct: 193 aaatgcatgacttgttacaagaaatgggatgggaaattgttcatcaagaatctatcaagg 252
Query: 998 atcctggacaacgcagcagattgtgggatcctgaggaagtttgtgatgt 1046
|||||||| ||| || |||| |||||||| |||||||| | ||||||
Sbjct: 253 atcctggaagacgaagtcgattatgggatccagaggaagtgtatgatgt 301