Miyakogusa Predicted Gene

Lj3g3v2576660.2

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2576660.2 Non Chatacterized Hit- tr|I1MK19|I1MK19_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.2720
PE=,85.3,0,alpha/beta-Hydrolases,NULL; no description,NULL; seg,NULL;
SUBFAMILY NOT NAMED,NULL; CGI-141-RELATED,CUFF.44280.2
         (1719 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69585 homologue to UniRef100_Q9LJI1 Cluster: Emb|CAB1...   109   6e-23
gnl|LJGI|TC78298 homologue to UniRef100_Q9LJI1 Cluster: Emb|CAB1...   101   1e-20
gnl|LJGI|TC73562                                                       68   2e-10

>gnl|LJGI|TC69585 homologue to UniRef100_Q9LJI1 Cluster: Emb|CAB10386.1; n=1;
           Arabidopsis thaliana|Rep: Emb|CAB10386.1 - Arabidopsis
           thaliana (Mouse-ear cress), partial (4%)
          Length = 1170

 Score =  109 bits (55), Expect = 6e-23
 Identities = 67/71 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcgactgcaaccatggccactgcagccggtgcagctgctcttttgtactacacattg 60
           ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 149 atggcgactgcaaccatggccactgcagccggtacaactgctcttttgtactacacattg 208

                      
Query: 61  aaccggaaatt 71
           ||  |||||||
Sbjct: 209 aataggaaatt 219


>gnl|LJGI|TC78298 homologue to UniRef100_Q9LJI1 Cluster: Emb|CAB10386.1; n=1;
           Arabidopsis thaliana|Rep: Emb|CAB10386.1 - Arabidopsis
           thaliana (Mouse-ear cress), partial (4%)
          Length = 1112

 Score =  101 bits (51), Expect = 1e-20
 Identities = 66/71 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcgactgcaaccatggccactgcagccggtgcagctgctcttttgtactacacattg 60
           ||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 457 atggcaactgcaaccatggccactgcagccggtacaactgctcttttgtactacacattg 516

                      
Query: 61  aaccggaaatt 71
           ||  |||||||
Sbjct: 517 aataggaaatt 527


>gnl|LJGI|TC73562 
          Length = 1318

 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                     
Query: 1   atggcgactgcaaccatggccactgcagccggtgcagctgct 42
           ||||||||||||||||||||||||||||||||| || |||||
Sbjct: 584 atggcgactgcaaccatggccactgcagccggtacaactgct 625