Miyakogusa Predicted Gene

Lj3g3v2542370.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2542370.1 Non Chatacterized Hit- tr|D8S4A7|D8S4A7_SELML
Putative uncharacterized protein OS=Selaginella
moelle,30.49,7e-18,coiled-coil,NULL; seg,NULL,CUFF.44157.1
         (987 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81926 similar to UniRef100_A7P6A2 Cluster: Chromosome...   170   1e-41
gnl|LJGI|FS344831 weakly similar to UniRef100_Q197X6 Cluster: Fa...   109   3e-23

>gnl|LJGI|TC81926 similar to UniRef100_A7P6A2 Cluster: Chromosome chr9 scaffold_7,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr9 scaffold_7, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (28%)
          Length = 742

 Score =  170 bits (86), Expect = 1e-41
 Identities = 185/218 (84%)
 Strand = Plus / Plus

                                                                       
Query: 46  cagaagatagctgctggagtgaaaatgagatggcaaaggaggcgagaaaagatggcggtt 105
           |||||||| | ||||||||||||  || ||||| |||||||||| | || || || ||| 
Sbjct: 525 cagaagattggtgctggagtgaagttgcgatgggaaaggaggcgtggaatgaaggtggta 584

                                                                       
Query: 106 caggaaacttgctgccttgagtggcagaatttaattgcacaagcttctagagaaggctat 165
           ||||| ||||||||| |||||||||| |||||||||||| ||| ||| ||  ||||||||
Sbjct: 585 caggagacttgctgctttgagtggcaaaatttaattgcagaaggttcaaggcaaggctat 644

                                                                       
Query: 166 gttgatcagaaagagctgcaatggaattcctatgaaaccttgtatgaagagttgaagctg 225
           |||| |||| ||||||||||||||||||||||||||| |||| ||||| ||||||||| |
Sbjct: 645 gttggtcaggaagagctgcaatggaattcctatgaaatcttggatgaacagttgaagcag 704

                                                 
Query: 226 gagttgctggtgagtgtcaaacaaaggaaacaaatgcc 263
           |||| | |||||||| |  | |||||||||| ||||||
Sbjct: 705 gagtggttggtgagtattgatcaaaggaaacgaatgcc 742


>gnl|LJGI|FS344831 weakly similar to UniRef100_Q197X6 Cluster: Farnesyl diphosphate
           synthase; n=1; Toxoplasma gondii|Rep: Farnesyl
           diphosphate synthase - Toxoplasma gondii, partial (3%)
          Length = 778

 Score =  109 bits (55), Expect = 3e-23
 Identities = 76/83 (91%)
 Strand = Plus / Plus

                                                                       
Query: 348 ccgcagaaaaggttacactacaaaggccaagtatcatgacattgaaggagctgaaatgaa 407
           |||||||| ||||| | |||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 473 ccgcagaagaggttgctctacaaaggccaagtatcatgacactgaaggagctgaaatgaa 532

                                  
Query: 408 gccaagaagaaggccaagtgatg 430
            ||||||||||||  ||||||||
Sbjct: 533 accaagaagaaggagaagtgatg 555