Miyakogusa Predicted Gene
- Lj3g3v2517860.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v2517860.2 Non Chatacterized Hit- tr|A5BUV6|A5BUV6_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,36.97,2e-18,SUBFAMILY NOT NAMED,NULL; BED FINGER-RELATED,NULL;
C2H2 and C2HC zinc fingers,NULL; Hermes dimerisat,CUFF.44128.2
(721 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS323294 UniRef100_A8I8R0 Cluster: Predicted protein; n... 88 9e-17
>gnl|LJGI|FS323294 UniRef100_A8I8R0 Cluster: Predicted protein; n=1; Chlamydomonas
reinhardtii|Rep: Predicted protein - Chlamydomonas
reinhardtii, partial (6%)
Length = 725
Score = 87.7 bits (44), Expect = 9e-17
Identities = 119/144 (82%)
Strand = Plus / Plus
Query: 181 tctattgtatgggatcatttcactaagcttcctttggttgagactaaaggtgaacataag 240
|||||||| |||||||| |||||||| |||||| || || ||| || ||||||||||||
Sbjct: 571 tctattgtgtgggatcacttcactaaacttcctatgaatgcgacgaagggtgaacataag 630
Query: 241 gccaaatgcaatcattgttgtgcaatagatagttgtcacccaaacaaacatggaaccaat 300
|| |||||||| |||||| || | || | | || |||||||| |||||||| || ||
Sbjct: 631 gcaaaatgcaaccattgtcgtaaagtatacaactgccacccaaataaacatggtacaaac 690
Query: 301 tctttgaacaaacatttgcgtagg 324
||| ||||||||||||||||||||
Sbjct: 691 tctatgaacaaacatttgcgtagg 714