Miyakogusa Predicted Gene
- Lj3g3v2515360.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v2515360.1 Non Chatacterized Hit- tr|Q2QVC1|Q2QVC1_ORYSJ
Argininosuccinate synthase, chloroplast, putative,
exp,80.7,3e-19,Arginosuc_synth,Argininosuccinate synthase; no
description,Argininosuccinate synthetase,
catalytic/m,NODE_58279_length_206_cov_131.689316.path1.1
(171 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC58939 similar to UniRef100_A7PHE8 Cluster: Chromosome... 291 7e-79
gnl|LJGI|FS358297 similar to UniRef100_Q9SZX3 Cluster: Argininos... 56 7e-08
gnl|LJGI|TC66162 similar to UniRef100_Q9SZX3 Cluster: Argininosu... 56 7e-08
>gnl|LJGI|TC58939 similar to UniRef100_A7PHE8 Cluster: Chromosome chr17 scaffold_16,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_16, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (93%)
Length = 1898
Score = 291 bits (147), Expect = 7e-79
Identities = 165/171 (96%)
Strand = Plus / Plus
Query: 1 atgtacatgatgtctgtagatcctgaggatgctccagacaagccagaatatgtggaaatt 60
|||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 898 atgtacatgatgtctgtagatcctgaggatgccccagacaaaccagaatatgtcgaaatt 957
Query: 61 gggatagaggcagggcttcctgtttcagtcaacgggaagaggctttcgccagcgtcgtta 120
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 958 gggatagaggcagggcttcctgtttcagtcaatgggaagaggctttcgccagcgtcatta 1017
Query: 121 ctagcagagctcaatgagattggcggaaggcatggaattggccgggttgac 171
||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1018 ctagcagagctcaatgagattggcggaaggcatggaattggccggattgac 1068
>gnl|LJGI|FS358297 similar to UniRef100_Q9SZX3 Cluster: Argininosuccinate synthase,
chloroplast precursor; n=1; Arabidopsis thaliana|Rep:
Argininosuccinate synthase, chloroplast precursor -
Arabidopsis thaliana (Mouse-ear cress), partial (43%)
Length = 801
Score = 56.0 bits (28), Expect = 7e-08
Identities = 91/112 (81%)
Strand = Plus / Minus
Query: 1 atgtacatgatgtctgtagatcctgaggatgctccagacaagccagaatatgtggaaatt 60
||||||||||| ||| ||| || ||||||||||| | | |||||||| ||||||||
Sbjct: 740 atgtacatgataactgcagacccagaggatgctcccaatgaaccagaatacgtggaaatc 681
Query: 61 gggatagaggcagggcttcctgtttcagtcaacgggaagaggctttcgccag 112
||||||||| || ||||||| ||||| || |||||||||||||| ||||
Sbjct: 680 gggatagagtatggtgttcctgtatcagtgaatgggaagaggctttcaccag 629
>gnl|LJGI|TC66162 similar to UniRef100_Q9SZX3 Cluster: Argininosuccinate synthase,
chloroplast precursor; n=1; Arabidopsis thaliana|Rep:
Argininosuccinate synthase, chloroplast precursor -
Arabidopsis thaliana (Mouse-ear cress), partial (43%)
Length = 850
Score = 56.0 bits (28), Expect = 7e-08
Identities = 91/112 (81%)
Strand = Plus / Plus
Query: 1 atgtacatgatgtctgtagatcctgaggatgctccagacaagccagaatatgtggaaatt 60
||||||||||| ||||||| || ||||||||||| | | |||||||| ||||||||
Sbjct: 56 atgtacatgataactgtagacccagaggatgctcccaatgaaccagaatacgtggaaatc 115
Query: 61 gggatagaggcagggcttcctgtttcagtcaacgggaagaggctttcgccag 112
||||||||| || ||||||| || || |||||||||| |||||| ||||
Sbjct: 116 gggatagagaatggtgttcctgtatcggtgaacgggaagaagctttcaccag 167