Miyakogusa Predicted Gene

Lj3g3v2484140.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2484140.1 tr|G7J515|G7J515_MEDTR 4-coumarate-coa ligase
OS=Medicago truncatula GN=MTR_3g088870 PE=4 SV=1,93.75,0,SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL; no description,NULL;
AMP-binding,AMP-dependent synt,CUFF.44099.1
         (483 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77728 weakly similar to UniRef100_Q84P23 Cluster: 4-c...   141   5e-33
gnl|LJGI|TC62381 homologue to UniRef100_Q8W558 Cluster: 4-coumar...    56   2e-07
gnl|LJGI|TC59755 homologue to UniRef100_Q8W558 Cluster: 4-coumar...    54   8e-07

>gnl|LJGI|TC77728 weakly similar to UniRef100_Q84P23 Cluster: 4-coumarate--CoA
           ligase-like 9; n=1; Arabidopsis thaliana|Rep:
           4-coumarate--CoA ligase-like 9 - Arabidopsis thaliana
           (Mouse-ear cress), partial (10%)
          Length = 502

 Score =  141 bits (71), Expect = 5e-33
 Identities = 71/71 (100%)
 Strand = Plus / Plus

                                                                       
Query: 413 gaaagcctggaagcaacatcactgcagctcaggtcatggagtttgttgcaaagcaggttg 472
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gaaagcctggaagcaacatcactgcagctcaggtcatggagtttgttgcaaagcaggttg 60

                      
Query: 473 caccgtacaag 483
           |||||||||||
Sbjct: 61  caccgtacaag 71


>gnl|LJGI|TC62381 homologue to UniRef100_Q8W558 Cluster: 4-coumarate:CoA ligase; n=1;
           Amorpha fruticosa|Rep: 4-coumarate:CoA ligase - Amorpha
           fruticosa, partial (59%)
          Length = 1215

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 250 ttcattgtagataggctgaaggaattgatcaaatataaag 289
           ||||| || |||||| ||||||||||||||||||||||||
Sbjct: 621 ttcatcgttgataggttgaaggaattgatcaaatataaag 660


>gnl|LJGI|TC59755 homologue to UniRef100_Q8W558 Cluster: 4-coumarate:CoA ligase; n=1;
           Amorpha fruticosa|Rep: 4-coumarate:CoA ligase - Amorpha
           fruticosa, partial (34%)
          Length = 833

 Score = 54.0 bits (27), Expect = 8e-07
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 250 ttcattgtagataggctgaaggaattgatcaaatataaagcttatcaggttcccccagct 309
           ||||| || |||||| ||||||||||||||||||| ||||  | ||||||| | ||||||
Sbjct: 224 ttcatcgttgataggttgaaggaattgatcaaatacaaaggatttcaggttgctccagct 283

              
Query: 310 gaa 312
           |||
Sbjct: 284 gaa 286