Miyakogusa Predicted Gene

Lj3g3v2483040.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2483040.1 Non Chatacterized Hit- tr|I1KHQ8|I1KHQ8_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,88.1,0,Pkinase,Protein kinase, catalytic domain; NAF,NAF domain;
no description,NULL; Protein kinase-like (,CUFF.44089.1
         (1509 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58276 UniRef100_Q53VM3 Cluster: Ser/Thr protein kinas...    80   5e-14
gnl|LJGI|TC57328 UniRef100_Q53VM3 Cluster: Ser/Thr protein kinas...    80   5e-14

>gnl|LJGI|TC58276 UniRef100_Q53VM3 Cluster: Ser/Thr protein kinase; n=1; Lotus
           japonicus|Rep: Ser/Thr protein kinase - Lotus japonicus,
           complete
          Length = 1876

 Score = 79.8 bits (40), Expect = 5e-14
 Identities = 106/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 715 tgtggaactccaaattatgttgctcctgaggttcttaatgatagaggttatgttggttct 774
           |||||||||||||||||||||||||| ||||| |||||||||| ||| |||| |||  | 
Sbjct: 815 tgtggaactccaaattatgttgctccagaggtccttaatgataaaggctatgatggagca 874

                                                                       
Query: 775 acatctgatatctggtcctgtggagtcattctctttgtacttatggctggttacttgccg 834
           ||  | ||| | ||||| ||||| || |||||||||||| |  | || ||||||||||| 
Sbjct: 875 actgcagatttgtggtcatgtggggtgattctctttgtattggttgcgggttacttgcct 934

                   
Query: 835 tttgatga 842
           ||||||||
Sbjct: 935 tttgatga 942


>gnl|LJGI|TC57328 UniRef100_Q53VM3 Cluster: Ser/Thr protein kinase; n=1; Lotus
           japonicus|Rep: Ser/Thr protein kinase - Lotus japonicus,
           partial (51%)
          Length = 916

 Score = 79.8 bits (40), Expect = 5e-14
 Identities = 106/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 715 tgtggaactccaaattatgttgctcctgaggttcttaatgatagaggttatgttggttct 774
           |||||||||||||||||||||||||| ||||| |||||||||| ||| |||| |||  | 
Sbjct: 763 tgtggaactccaaattatgttgctccagaggtccttaatgataaaggctatgatggagca 822

                                                                       
Query: 775 acatctgatatctggtcctgtggagtcattctctttgtacttatggctggttacttgccg 834
           ||  | ||| | ||||| ||||| || |||||||||||| |  | || ||||||||||| 
Sbjct: 823 actgcagatttgtggtcatgtggggtgattctctttgtattggttgcgggttacttgcct 882

                   
Query: 835 tttgatga 842
           ||||||||
Sbjct: 883 tttgatga 890