Miyakogusa Predicted Gene

Lj3g3v2482010.1
Show Alignment:  
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2482010.1 gene.Ljchr3_pseudomol_20120830.path1.gene5400.1
         (213 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72653 homologue to UniRef100_Q8HYZ5 Cluster: Alkaline...   274   2e-73

>gnl|LJGI|TC72653 homologue to UniRef100_Q8HYZ5 Cluster: Alkaline phosphatase; n=1;
           Sus scrofa|Rep: Alkaline phosphatase - Sus scrofa (Pig),
           partial (6%)
          Length = 494

 Score =  274 bits (138), Expect = 2e-73
 Identities = 144/146 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgcgcgatcccaatttggctcgccgtcaagatcggtggacaccactgcgcttcctctgg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 208 atgcgcgatcccaatttggctcgccgtcaagatcggtggacaccactgcgcttcctctgg 149

                                                                       
Query: 61  acggcactgctagggctcgacgccgccgcctctggttcaccttcgccgccgcctctggtt 120
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148 acggcactgctagggttcgacgccgccgcctctggttcaccttcgccgccgcctctggtt 89

                                     
Query: 121 caccttcaccgcctctctgcttctct 146
           ||||||||||||||||| ||||||||
Sbjct: 88  caccttcaccgcctctccgcttctct 63