Miyakogusa Predicted Gene

Lj3g3v2214670.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2214670.1 Non Chatacterized Hit- tr|I1NC79|I1NC79_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.17876
PE,80.39,5e-18,TruD,Pseudouridine synthase, TruD; TRUD,Pseudouridine
synthase, TruD, insertion domain; Pseudouridin,CUFF.43684.1
         (159 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70929 similar to UniRef100_O82090 Cluster: Fiber anne...    62   1e-09

>gnl|LJGI|TC70929 similar to UniRef100_O82090 Cluster: Fiber annexin; n=1;
          Gossypium hirsutum|Rep: Fiber annexin - Gossypium
          hirsutum (Upland cotton) (Gossypium mexicanum), partial
          (35%)
          Length = 981

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 42 tgcagcaagtacaagggtgcaaaaatatgga 72
          |||||||||||||||||||||||||||||||
Sbjct: 1  tgcagcaagtacaagggtgcaaaaatatgga 31