Miyakogusa Predicted Gene
- Lj3g3v2210420.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v2210420.1 tr|E5GCC1|E5GCC1_CUCME AP2/ERF domain-containing
transcription factor (Fragment) OS=Cucumis melo sub,49.52,1e-16,SHN
(SHINE), DNA BINDING / TRANSCRIPTION FACTOR,NULL;
seg,NULL,gene.g48645.t1.1
(397 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AU088998 homologue to UniRef100_Q2HUA6 Cluster: Pathoge... 178 2e-44
gnl|LJGI|BP035843 homologue to UniRef100_A7QIP9 Cluster: Chromos... 74 7e-13
gnl|LJGI|TC79408 similar to UniRef100_Q3E958 Cluster: Ethylene-r... 52 3e-06
>gnl|LJGI|AU088998 homologue to UniRef100_Q2HUA6 Cluster: Pathogenesis-related
transcriptional factor and ERF; n=1; Medicago
truncatula|Rep: Pathogenesis-related transcriptional
factor and ERF - Medicago truncatula (Barrel medic),
partial (39%)
Length = 550
Score = 178 bits (90), Expect = 2e-44
Identities = 213/254 (83%)
Strand = Plus / Plus
Query: 1 atgagtggaaggaatgccaagacaaacttccctgttgctgataaaccaatgggaaatcac 60
||||||||||| || ||||| || |||||||| |||| ||| | | ||||||||||
Sbjct: 8 atgagtggaagaaacgccaaaactaacttcccagttgtggatgatcaaatgggaaattct 67
Query: 61 agctctacttcctcttccacaacattatctgcagttctgagtgcaaagctcagaaaatgc 120
| ||| |||| | |||||||||||| ||| ||||||| ||||||||||| || || |||
Sbjct: 68 acttctgcttcattttccacaacattttctacagttctcagtgcaaagctgaggaagtgc 127
Query: 121 tgcaagtccccttcaccttccctcacttgcctgaggcttgacactgagaattcccacatt 180
| |||||||||||||||||||||||| ||||| |||||||| | |||||||||||| |
Sbjct: 128 ttcaagtccccttcaccttccctcacatgcctaaggcttgatgcagagaattcccacttc 187
Query: 181 ggggtgtggcagaagcgagcagggcctcgttctgattcaaattggatcatgatggtggag 240
|| ||||||||||||| ||| |||||||| || || ||||| |||||||||||||| |||
Sbjct: 188 ggcgtgtggcagaagcaagccgggcctcgctccgaatcaaactggatcatgatggttgag 247
Query: 241 ttggaaaggaagaa 254
|| |||||||||||
Sbjct: 248 ttagaaaggaagaa 261
>gnl|LJGI|BP035843 homologue to UniRef100_A7QIP9 Cluster: Chromosome chr9
scaffold_104, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr9 scaffold_104, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (11%)
Length = 393
Score = 73.8 bits (37), Expect = 7e-13
Identities = 52/57 (91%)
Strand = Plus / Minus
Query: 338 tggatgaggagcaaaggattgctctgcagatgatagaggagcttctgaacagaaatt 394
||||||||||||| |||||||| |||||||||||||| || ||||||||||| ||||
Sbjct: 367 tggatgaggagcagaggattgcactgcagatgatagaagaacttctgaacaggaatt 311
>gnl|LJGI|TC79408 similar to UniRef100_Q3E958 Cluster: Ethylene-responsive
transcription factor SHINE 3; n=1; Arabidopsis
thaliana|Rep: Ethylene-responsive transcription factor
SHINE 3 - Arabidopsis thaliana (Mouse-ear cress),
partial (65%)
Length = 943
Score = 52.0 bits (26), Expect = 3e-06
Identities = 45/50 (90%), Gaps = 1/50 (2%)
Strand = Plus / Plus
Query: 164 ctgagaattcccacattggggtgtggcagaagcgagcagggcctcgttct 213
|||| |||||||||||||| |||||||| ||| |||||||||||| ||||
Sbjct: 480 ctgataattcccacattggagtgtggcaaaag-gagcagggcctcattct 528