Miyakogusa Predicted Gene

Lj3g3v2210420.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2210420.1 tr|E5GCC1|E5GCC1_CUCME AP2/ERF domain-containing
transcription factor (Fragment) OS=Cucumis melo sub,49.52,1e-16,SHN
(SHINE), DNA BINDING / TRANSCRIPTION FACTOR,NULL;
seg,NULL,gene.g48645.t1.1
         (397 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AU088998 homologue to UniRef100_Q2HUA6 Cluster: Pathoge...   178   2e-44
gnl|LJGI|BP035843 homologue to UniRef100_A7QIP9 Cluster: Chromos...    74   7e-13
gnl|LJGI|TC79408 similar to UniRef100_Q3E958 Cluster: Ethylene-r...    52   3e-06

>gnl|LJGI|AU088998 homologue to UniRef100_Q2HUA6 Cluster: Pathogenesis-related
           transcriptional factor and ERF; n=1; Medicago
           truncatula|Rep: Pathogenesis-related transcriptional
           factor and ERF - Medicago truncatula (Barrel medic),
           partial (39%)
          Length = 550

 Score =  178 bits (90), Expect = 2e-44
 Identities = 213/254 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagtggaaggaatgccaagacaaacttccctgttgctgataaaccaatgggaaatcac 60
           ||||||||||| || ||||| || |||||||| ||||  ||| | | ||||||||||   
Sbjct: 8   atgagtggaagaaacgccaaaactaacttcccagttgtggatgatcaaatgggaaattct 67

                                                                       
Query: 61  agctctacttcctcttccacaacattatctgcagttctgagtgcaaagctcagaaaatgc 120
           |  ||| |||| | |||||||||||| ||| ||||||| ||||||||||| || || |||
Sbjct: 68  acttctgcttcattttccacaacattttctacagttctcagtgcaaagctgaggaagtgc 127

                                                                       
Query: 121 tgcaagtccccttcaccttccctcacttgcctgaggcttgacactgagaattcccacatt 180
           | |||||||||||||||||||||||| ||||| ||||||||  | |||||||||||| | 
Sbjct: 128 ttcaagtccccttcaccttccctcacatgcctaaggcttgatgcagagaattcccacttc 187

                                                                       
Query: 181 ggggtgtggcagaagcgagcagggcctcgttctgattcaaattggatcatgatggtggag 240
           || ||||||||||||| ||| |||||||| || || ||||| |||||||||||||| |||
Sbjct: 188 ggcgtgtggcagaagcaagccgggcctcgctccgaatcaaactggatcatgatggttgag 247

                         
Query: 241 ttggaaaggaagaa 254
           || |||||||||||
Sbjct: 248 ttagaaaggaagaa 261


>gnl|LJGI|BP035843 homologue to UniRef100_A7QIP9 Cluster: Chromosome chr9
           scaffold_104, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr9 scaffold_104, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (11%)
          Length = 393

 Score = 73.8 bits (37), Expect = 7e-13
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 338 tggatgaggagcaaaggattgctctgcagatgatagaggagcttctgaacagaaatt 394
           ||||||||||||| |||||||| |||||||||||||| || ||||||||||| ||||
Sbjct: 367 tggatgaggagcagaggattgcactgcagatgatagaagaacttctgaacaggaatt 311


>gnl|LJGI|TC79408 similar to UniRef100_Q3E958 Cluster: Ethylene-responsive
           transcription factor SHINE 3; n=1; Arabidopsis
           thaliana|Rep: Ethylene-responsive transcription factor
           SHINE 3 - Arabidopsis thaliana (Mouse-ear cress),
           partial (65%)
          Length = 943

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 45/50 (90%), Gaps = 1/50 (2%)
 Strand = Plus / Plus

                                                             
Query: 164 ctgagaattcccacattggggtgtggcagaagcgagcagggcctcgttct 213
           |||| |||||||||||||| |||||||| ||| |||||||||||| ||||
Sbjct: 480 ctgataattcccacattggagtgtggcaaaag-gagcagggcctcattct 528