Miyakogusa Predicted Gene

Lj3g3v2040180.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v2040180.1 tr|G7JVJ8|G7JVJ8_MEDTR Mandelonitrile lyase
OS=Medicago truncatula GN=MTR_4g005860 PE=3
SV=1,77.96,0,GMC_OXRED_1,Glucose-methanol-choline oxidoreductase,
N-terminal; GMC_OXRED_2,Glucose-methanol-cholin,CUFF.43491.1
         (1683 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC595672 homologue to UniRef100_A7PC60 Cluster: Chromos...   163   4e-39

>gnl|LJGI|DC595672 homologue to UniRef100_A7PC60 Cluster: Chromosome chr2 scaffold_11,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr2 scaffold_11, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (8%)
          Length = 299

 Score =  163 bits (82), Expect = 4e-39
 Identities = 122/134 (91%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                       
Query: 843 gattctgcgggaacgcggtg-aggtgattcttgctgctggtgcgattgggagtcctcagc 901
           |||||| ||||||| ||||| ||||||||||  |||||||||||||||| || |||||||
Sbjct: 166 gattcttcgggaacacggtgcaggtgattctctctgctggtgcgattggaagccctcagc 225

                                                                       
Query: 902 ttcttcttctcagtgggattgggccgagatcttacctttcttcatgggggattccggtgg 961
           |||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 226 ttcttcttcttagtgggattggaccgagatcttacctttcttcatgggggattcccgtgg 285

                         
Query: 962 cgcatcatcttccc 975
           |  |||||||||||
Sbjct: 286 cttatcatcttccc 299