Miyakogusa Predicted Gene

Lj3g3v1932900.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1932900.1 Non Chatacterized Hit- tr|I1KFV4|I1KFV4_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,78.68,0,seg,NULL;
FAD-binding domain,FAD-binding, type 2; FAD_binding_4,FAD linked
oxidase, N-terminal; FAMI,CUFF.43306.1
         (1135 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79274 similar to UniRef100_Q2HTY5 Cluster: FAD linked...    66   5e-10

>gnl|LJGI|TC79274 similar to UniRef100_Q2HTY5 Cluster: FAD linked oxidase,
           N-terminal; n=1; Medicago truncatula|Rep: FAD linked
           oxidase, N-terminal - Medicago truncatula (Barrel
           medic), partial (71%)
          Length = 1252

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 623 ttcttgatagaaaatcaatgggagaagatgttttctgggccattagaggaggtagtgcta 682
           ||||||||||||| || |||||||||||| | || ||||| |||| ||||||| |||   
Sbjct: 306 ttcttgatagaaagtctatgggagaagatctattttgggctattaaaggaggtggtgggg 365

                                            
Query: 683 ctagttttggagtcattcttgcatggaagatca 715
           | |||||||| ||||||||  ||||||||||||
Sbjct: 366 ccagttttggggtcattctgtcatggaagatca 398