Miyakogusa Predicted Gene
- Lj3g3v1866030.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v1866030.1 Non Chatacterized Hit- tr|B9S6M6|B9S6M6_RICCO
Arsenite-resistance protein, putative OS=Ricinus
commu,47.34,0.0000000000003,seg,NULL,CUFF.43276.1
(534 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC65267 homologue to UniRef100_A7QAH7 Cluster: Chromoso... 615 e-175
gnl|LJGI|DC599744 weakly similar to UniRef100_A8J790 Cluster: Hy... 202 2e-51
gnl|LJGI|BP082693 UniRef100_Q9VLI3 Cluster: CG12438-PA; n=1; Dro... 157 8e-38
gnl|LJGI|TC81837 similar to UniRef100_Q9ZVD0 Cluster: Expressed ... 66 2e-10
>gnl|LJGI|TC65267 homologue to UniRef100_A7QAH7 Cluster: Chromosome undetermined
scaffold_71, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_71, whole
genome shotgun sequence - Vitis vinifera (Grape),
partial (24%)
Length = 759
Score = 615 bits (310), Expect = e-175
Identities = 359/377 (95%), Gaps = 3/377 (0%)
Strand = Plus / Plus
Query: 138 accacctgcccgcaggagggacaggcgggacgaccgggatttcgatcgtccacctaaccg 197
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 256 accacctgcccgcaggagggacaggcgggacgaccgggatttcgatcgtccacctaaccg 315
Query: 198 ccgcgattactacgaccgcagcaacaactnnnnnnngcccaaagaccgggacagggactt 257
||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 316 ccgcgattactacgaccgcagcaacaactcccccccgcccaaagaccgggacagggactt 375
Query: 258 caagcgccgccgcagcccctcacctccttcccaacgcgaccgcgaccgccgtcactcccc 317
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 376 caagcgccgccgcagcccctcacctccttcccaacgcgaccgcgaccgccgtcactcccc 435
Query: 318 tcctcccccctacaagcgttccaggagaggtagtccccgcggtggttaccgttacggtcc 377
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 436 tcctcccccctacaagcgttccaggagaggtagtccccgcggtggttaccgttacggtcc 495
Query: 378 cgatgacagcggatttggatatgataattctggcggttatgaacggggagtgggtggaag 437
|||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 496 cgatgaca---gatttggatatgataattctggcggttatgaacggggaatgggtggaag 552
Query: 438 ggttggttatgtcgatgacaagtcttctggccgatttggacatcgttctgctgggggaca 497
|||||||||||||||||||||||||| |||||| |||||||||||||| ||||| | | |
Sbjct: 553 ggttggttatgtcgatgacaagtcttatggccggtttggacatcgttcagctggagaata 612
Query: 498 tcaaaatgggatttctg 514
||||||||| |||||||
Sbjct: 613 tcaaaatggtatttctg 629
Score = 83.8 bits (42), Expect = 1e-15
Identities = 42/42 (100%)
Strand = Plus / Plus
Query: 1 atggcggaggtcatcaacgctcccccggattcactcgacaaa 42
||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113 atggcggaggtcatcaacgctcccccggattcactcgacaaa 154
>gnl|LJGI|DC599744 weakly similar to UniRef100_A8J790 Cluster: Hydroxyproline-rich
glycoprotein, stress-induced; n=1; Chlamydomonas
reinhardtii|Rep: Hydroxyproline-rich glycoprotein,
stress-induced - Chlamydomonas reinhardtii, partial (8%)
Length = 337
Score = 202 bits (102), Expect = 2e-51
Identities = 116/123 (94%)
Strand = Plus / Plus
Query: 138 accacctgcccgcaggagggacaggcgggacgaccgggatttcgatcgtccacctaaccg 197
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 accacctgcccgcaggagggacaggcgggacgaccgggatttcgatcgtccacctaaccg 274
Query: 198 ccgcgattactacgaccgcagcaacaactnnnnnnngcccaaagaccgggacagggactt 257
||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 275 ccgcgattactacgaccgcagcaacaactcccccccgcccaaagaccgggacagggactt 334
Query: 258 caa 260
|||
Sbjct: 335 caa 337
Score = 83.8 bits (42), Expect = 1e-15
Identities = 42/42 (100%)
Strand = Plus / Plus
Query: 1 atggcggaggtcatcaacgctcccccggattcactcgacaaa 42
||||||||||||||||||||||||||||||||||||||||||
Sbjct: 78 atggcggaggtcatcaacgctcccccggattcactcgacaaa 119
>gnl|LJGI|BP082693 UniRef100_Q9VLI3 Cluster: CG12438-PA; n=1; Drosophila
melanogaster|Rep: CG12438-PA - Drosophila melanogaster
(Fruit fly), partial (5%)
Length = 370
Score = 157 bits (79), Expect = 8e-38
Identities = 79/79 (100%)
Strand = Plus / Minus
Query: 456 caagtcttctggccgatttggacatcgttctgctgggggacatcaaaatgggatttctgg 515
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370 caagtcttctggccgatttggacatcgttctgctgggggacatcaaaatgggatttctgg 311
Query: 516 tatggcagctgtataggac 534
|||||||||||||||||||
Sbjct: 310 tatggcagctgtataggac 292
>gnl|LJGI|TC81837 similar to UniRef100_Q9ZVD0 Cluster: Expressed protein; n=1;
Arabidopsis thaliana|Rep: Expressed protein -
Arabidopsis thaliana (Mouse-ear cress), partial (18%)
Length = 1241
Score = 65.9 bits (33), Expect = 2e-10
Identities = 84/101 (83%)
Strand = Plus / Plus
Query: 406 tctggcggttatgaacggggagtgggtggaagggttggttatgtcgatgacaagtcttct 465
||||| || |||||||||||||||||||||||| |||||| | |||| | ||| | |
Sbjct: 505 tctggtggctatgaacggggagtgggtggaaggactggttacgcaaatgaaaggtcgtat 564
Query: 466 ggccgatttggacatcgttctgctgggggacatcaaaatgg 506
||| | ||||||||||| |||||||||||| |||||||||
Sbjct: 565 ggcaggtttggacatcgatctgctgggggatttcaaaatgg 605
Score = 54.0 bits (27), Expect = 9e-07
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 241 gaccgggacagggacttcaagcgccgccgcagccc 275
||||| || ||||||||||||||||||||||||||
Sbjct: 349 gaccgtgatagggacttcaagcgccgccgcagccc 383