Miyakogusa Predicted Gene

Lj3g3v1844260.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1844260.1 Non Chatacterized Hit- tr|I1MM77|I1MM77_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.30437
PE,61.99,0,TIR,Toll/interleukin-1 receptor homology (TIR) domain;
Toll/Interleukin receptor TIR domain,Toll/int,CUFF.43198.1
         (3105 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC597742 similar to UniRef100_A2Q6C2 Cluster: TIR; n=1;...   224   3e-57
gnl|LJGI|TC71043 weakly similar to UniRef100_A2Q6C2 Cluster: TIR...   119   1e-25
gnl|LJGI|DC595824 similar to UniRef100_A2Q6G3 Cluster: TIR; AAA ...    66   1e-09
gnl|LJGI|FS319481 similar to UniRef100_A2Q6G3 Cluster: TIR; AAA ...    60   9e-08
gnl|LJGI|FS322253 similar to UniRef100_A2Q6G3 Cluster: TIR; AAA ...    60   9e-08

>gnl|LJGI|DC597742 similar to UniRef100_A2Q6C2 Cluster: TIR; n=1; Medicago
            truncatula|Rep: TIR - Medicago truncatula (Barrel medic),
            partial (16%)
          Length = 590

 Score =  224 bits (113), Expect = 3e-57
 Identities = 209/241 (86%)
 Strand = Plus / Plus

                                                                        
Query: 2048 agttgaaatctttgaaaactctcatcatttcgggttgttcaaaaattgacaaattagaag 2107
            ||||||||||||||| |||||||||| |||| ||||||||||||||||| || || ||||
Sbjct: 12   agttgaaatctttgacaactctcatcctttcaggttgttcaaaaattgataagttggaag 71

                                                                        
Query: 2108 aagatatagtgcaaatggaatccttgacaactctaattgcagaaaatactgctgtgaaac 2167
            ||||||||||||| ||||||||||||||||| || |||||| || |||| ||| | ||  
Sbjct: 72   aagatatagtgcagatggaatccttgacaacacttattgcaaaagatacagctataaagg 131

                                                                        
Query: 2168 aagtgcccttttcaattgtaagatcaaaaagcattggatatatatccctgtgtggctatg 2227
            |||| |||| ||||||  ||||||  |||||||| |||||||||||| | ||||| ||||
Sbjct: 132  aagttccctattcaatactaagattgaaaagcataggatatatatccttatgtggatatg 191

                                                                        
Query: 2228 aaggattagcacatgatgtttttccttcgctcatttggtcttggatgtctccaacaatga 2287
            |||||||| ||| ||||||||||||||| |||||| ||||||||||||| || |||||||
Sbjct: 192  aaggattaacacgtgatgtttttccttctctcattcggtcttggatgtcacccacaatga 251

             
Query: 2288 a 2288
            |
Sbjct: 252  a 252


>gnl|LJGI|TC71043 weakly similar to UniRef100_A2Q6C2 Cluster: TIR; n=1; Medicago
           truncatula|Rep: TIR - Medicago truncatula (Barrel
           medic), partial (5%)
          Length = 580

 Score =  119 bits (60), Expect = 1e-25
 Identities = 117/136 (86%)
 Strand = Plus / Minus

                                                                       
Query: 5   cttcttcgtccaccaatcgtcaatggctgtacgacgtgttcatcaacttcaggggaaaag 64
           ||||||| ||| | |||| ||||||| | |||||||||||||||||||||||||||||||
Sbjct: 231 cttcttcatcctcgaatcatcaatggatatacgacgtgttcatcaacttcaggggaaaag 172

                                                                       
Query: 65  acacccgtggcaacttcgtttctcatctccatgccgccctttcaaacgccggagtcaacg 124
           |||| |||  || |||||||||||||||| |  | || || |||||||| ||||||||||
Sbjct: 171 acacacgtcacagcttcgtttctcatctctacactgctctctcaaacgcaggagtcaacg 112

                           
Query: 125 ctttcctcgacgatga 140
            |||||| ||||||||
Sbjct: 111 ttttcctggacgatga 96


>gnl|LJGI|DC595824 similar to UniRef100_A2Q6G3 Cluster: TIR; AAA ATPase; n=1; Medicago
            truncatula|Rep: TIR; AAA ATPase - Medicago truncatula
            (Barrel medic), partial (5%)
          Length = 575

 Score = 65.9 bits (33), Expect = 1e-09
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                        
Query: 2216 tgtgtggctatgaaggattagcacatgatgtttttccttcgctcatttggtcttggatgt 2275
            |||| ||| ||||||||||  ||| |||||| ||||||||  ||||||||||||||||||
Sbjct: 4    tgtgcggccatgaaggattctcacgtgatgtgtttccttctatcatttggtcttggatgt 63

                     
Query: 2276 ctccaacaa 2284
            | |||||||
Sbjct: 64   caccaacaa 72


>gnl|LJGI|FS319481 similar to UniRef100_A2Q6G3 Cluster: TIR; AAA ATPase; n=1; Medicago
            truncatula|Rep: TIR; AAA ATPase - Medicago truncatula
            (Barrel medic), partial (16%)
          Length = 710

 Score = 60.0 bits (30), Expect = 9e-08
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1411 attgaaaggaataacaagcttggaatgcatgatctgcttcgagatatgggaagagagatt 1470
            ||||| ||||| |||||| | |||||||||||| |||| ||||| ||||||||||| |||
Sbjct: 295  attgataggaagaacaagatcggaatgcatgatttgctacgagacatgggaagagatatt 354

              
Query: 1471 gt 1472
            ||
Sbjct: 355  gt 356


>gnl|LJGI|FS322253 similar to UniRef100_A2Q6G3 Cluster: TIR; AAA ATPase; n=1; Medicago
            truncatula|Rep: TIR; AAA ATPase - Medicago truncatula
            (Barrel medic), partial (11%)
          Length = 680

 Score = 60.0 bits (30), Expect = 9e-08
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1411 attgaaaggaataacaagcttggaatgcatgatctgcttcgagatatgggaagagagatt 1470
            ||||| ||||| |||||| | |||||||||||| |||| ||||| ||||||||||| |||
Sbjct: 211  attgataggaagaacaagatcggaatgcatgatttgctacgagacatgggaagagatatt 270

              
Query: 1471 gt 1472
            ||
Sbjct: 271  gt 272