Miyakogusa Predicted Gene

Lj3g3v1776380.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1776380.1 Non Chatacterized Hit- tr|E9HSG9|E9HSG9_DAPPU
Putative uncharacterized protein OS=Daphnia pulex
GN=D,28.33,1.2,seg,NULL,CUFF.43108.1
         (619 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74004 similar to UniRef100_Q9SWV4 Cluster: ER66 prote...    58   7e-08
gnl|LJGI|TC61814 similar to UniRef100_Q0G582 Cluster: SAM (And s...    58   7e-08
gnl|LJGI|FS340033 similar to UniRef100_A8DYM0 Cluster: CG11206-P...    56   3e-07
gnl|LJGI|TC65680 similar to UniRef100_A7PB59 Cluster: Chromosome...    52   4e-06

>gnl|LJGI|TC74004 similar to UniRef100_Q9SWV4 Cluster: ER66 protein; n=1; Solanum
           lycopersicum|Rep: ER66 protein - Solanum lycopersicum
           (Tomato) (Lycopersicon esculentum), partial (27%)
          Length = 1169

 Score = 58.0 bits (29), Expect = 7e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 336 gggaattagatttcccacccctgggtttagaattgccaccc 376
           |||||||||||||||||||||  | ||||||||||||||||
Sbjct: 791 gggaattagatttcccaccccctgttttagaattgccaccc 831


>gnl|LJGI|TC61814 similar to UniRef100_Q0G582 Cluster: SAM (And some other
           nucleotide) binding motif:Site-specific DNA-
           methyltransferase (Cytosine-N4-specific):N-6; n=1;
           Fulvimarina pelagi HTCC2506|Rep: SAM (And some other
           nucleotide) binding motif:Site-specific DNA-
           methyltransferase (Cytosine-N4-specific):N-6 -
           Fulvimarina pelagi HTCC2506, partial (5%)
          Length = 1192

 Score = 58.0 bits (29), Expect = 7e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 336 gggaattagatttcccacccctgggtttagaattgccaccc 376
           |||||||||||||||||||||  | ||||||||||||||||
Sbjct: 893 gggaattagatttcccaccccctgttttagaattgccaccc 933


>gnl|LJGI|FS340033 similar to UniRef100_A8DYM0 Cluster: CG11206-PC  isoform C; n=2;
           Drosophila melanogaster|Rep: CG11206-PC  isoform C -,
           partial (1%)
          Length = 782

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 44/48 (91%), Gaps = 1/48 (2%)
 Strand = Plus / Plus

                                                           
Query: 338 gaattagatttcccacccctgggtttagaattgccaccccatttaaaa 385
           |||||||||||||||||||| | |||||| || |||||||||||||||
Sbjct: 736 gaattagatttcccacccct-gttttagatttcccaccccatttaaaa 782


>gnl|LJGI|TC65680 similar to UniRef100_A7PB59 Cluster: Chromosome chr16 scaffold_10,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr16 scaffold_10, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (21%)
          Length = 818

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 331 ttaaagggaattagatttcccacccc 356
           ||||||||||||||||||||||||||
Sbjct: 29  ttaaagggaattagatttcccacccc 4