Miyakogusa Predicted Gene

Lj3g3v1667280.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1667280.1 Non Chatacterized Hit- tr|I1MGE4|I1MGE4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.27058
PE,77.27,0.000000000003, ,CUFF.42972.1
         (216 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70185                                                      194   1e-49

>gnl|LJGI|TC70185 
          Length = 590

 Score =  194 bits (98), Expect = 1e-49
 Identities = 116/122 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggagggagcagaagaaggagtggagatgatgctggattccaaggacatgcaacaacag 60
           |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 114 atggagggtgcagaagaaggagtggagatgatgctggattccaaggacatgcagcagcag 173

                                                                       
Query: 61  agcaaagccttcgacaagctcactgagggcgtcgaggatcgccaggtcgattccactcgc 120
           ||||||||||||||||||||||||||  ||||||||||||||||| ||||||||||||||
Sbjct: 174 agcaaagccttcgacaagctcactgaccgcgtcgaggatcgccagctcgattccactcgc 233

             
Query: 121 gt 122
           ||
Sbjct: 234 gt 235