Miyakogusa Predicted Gene
- Lj3g3v1631880.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v1631880.1 CUFF.42894.1
(780 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AV777489 weakly similar to UniRef100_A4GN92 Cluster: RB... 172 2e-42
gnl|LJGI|FS347457 weakly similar to UniRef100_Q6TAF7 Cluster: Bl... 58 9e-08
gnl|LJGI|TC61013 weakly similar to UniRef100_A7Q237 Cluster: Chr... 58 9e-08
>gnl|LJGI|AV777489 weakly similar to UniRef100_A4GN92 Cluster: RB; n=1; Solanum
verrucosum|Rep: RB - Solanum verrucosum, partial (6%)
Length = 451
Score = 172 bits (87), Expect = 2e-42
Identities = 303/375 (80%)
Strand = Plus / Plus
Query: 59 agcttggcctatttctgggttttgatcaaaacttgaacaggctttccagaaccctcactg 118
||||||||| ||||||||||||||| || | |||| ||||| || || || |||||||
Sbjct: 29 agcttggccagtttctgggttttgatgaagaattgacaaggctctctagcacgctcactg 88
Query: 119 caatcaaagctacgctcgaagatgctgaggagaggcaattctcaaacagggctgtaaagg 178
||||||| || || || |||||||||||||||| |||||| | | || ||| | ||||
Sbjct: 89 caatcaaggcaacacttgaagatgctgaggagaaacaattcactgatagagctattaagg 148
Query: 179 attggttgcaaaagttagcagatgcagcttacatcctggatgacatcttggatgagtgtg 238
|||| |||||||| || |||||| ||| | | ||||||||||||||||| |||||||
Sbjct: 149 tttggctgcaaaagctaagagatgctgctcatgttctggatgacatcttggacgagtgtg 208
Query: 239 ccactgaagcattgaaattagagtatgaaggattcaagtgtggactatcggacaatttgc 298
|||||||||||||||| | ||| ||| |||||||| |||||| |||| ||||| |||
Sbjct: 209 ccactgaagcattgaagatggagaatggaggattcatgtgtggtttatcagacaaggtgc 268
Query: 299 aaaactcttgcttatcctcttttcgtcccaagaatcttgttttccgacacaaaatggtca 358
||| ||||||||||| |||||||| ||||||| || |||| ||||| | ||| | |
Sbjct: 269 aaagctcttgcttattctcttttcatcccaagcatgttgtcttccgttgtacaattgcta 328
Query: 359 ataaaatgaagggaataagagagagattagatgaaattgctgaagaaaggagtaagtttc 418
| ||||||||| ||||| ||||||||||||||| ||||| |||| |||| || |||||
Sbjct: 329 agaaaatgaagatgataagggagagattagatgaagttgctcaagagaggactaggtttc 388
Query: 419 atttgaatgagatgg 433
|||| | ||||||||
Sbjct: 389 atttaactgagatgg 403
>gnl|LJGI|FS347457 weakly similar to UniRef100_Q6TAF7 Cluster: Blight resistance
protein T118; n=1; Solanum tarijense|Rep: Blight
resistance protein T118 - Solanum tarijense, partial
(9%)
Length = 786
Score = 58.0 bits (29), Expect = 9e-08
Identities = 41/45 (91%)
Strand = Plus / Minus
Query: 577 gtctatccaatagtaggtcccggtggaattgggaaaacaacactt 621
|||||||| ||||| |||| ||||||||| |||||||||||||||
Sbjct: 342 gtctatcccatagttggtctcggtggaatggggaaaacaacactt 298
>gnl|LJGI|TC61013 weakly similar to UniRef100_A7Q237 Cluster: Chromosome chr13
scaffold_45, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr13 scaffold_45, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (4%)
Length = 1145
Score = 58.0 bits (29), Expect = 9e-08
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 577 gtctatccaatagtaggtcccggtggaattgggaaaacaacactt 621
|||||||| ||||| |||| ||||||||| |||||||||||||||
Sbjct: 759 gtctatcccatagttggtctcggtggaatggggaaaacaacactt 803