Miyakogusa Predicted Gene

Lj3g3v1605120.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1605120.1 Non Chatacterized Hit- tr|Q0AQZ6|Q0AQZ6_MARMM
Putative uncharacterized protein OS=Maricaulis maris
(,47.47,2e-19,DUF962,Protein of unknown function DUF962;
seg,NULL,CUFF.42862.1
         (339 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63119 similar to UniRef100_A7PP06 Cluster: Chromosome...   143   8e-34

>gnl|LJGI|TC63119 similar to UniRef100_A7PP06 Cluster: Chromosome chr8 scaffold_23,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_23, whole genome shotgun
           sequence - Vitis vinifera (Grape), complete
          Length = 783

 Score =  143 bits (72), Expect = 8e-34
 Identities = 186/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 109 ttgctctgctcggttttcttcagctggtggttcttgttctttgttcctttctttggttat 168
           |||||||| || ||||| |||||||||||| ||||||||||||| ||||| | ||| |||
Sbjct: 392 ttgctctgttcagttttgttcagctggtggctcttgttctttgtgcctttatctgggtat 451

                                                                       
Query: 169 ggatgtgctgtgtatagtcacttgtttgttgagaggaatttccctgcgacttttggatac 228
           || |||||   ||||||||| || ||||||||  ||||| | ||||| ||||||||  ||
Sbjct: 452 ggttgtgcctggtatagtcatttctttgttgaagggaatgttcctgccacttttgggcac 511

                                                                       
Query: 229 cccttttggtctgttttgtgtgatttgaagatgtttgggtttatgcttactgggaaaatg 288
           |||||||||||  |  | |||||||  ||||||||||| || ||||| || ||  |||||
Sbjct: 512 cccttttggtcactcatttgtgattacaagatgtttggtttaatgctcaccggacaaatg 571

                                                       
Query: 289 gatagagagatcaaaaggcttgggaagagacctgtgctgcaagt 332
           |||||||||||||| |||||||||||  |||||||| |||||||
Sbjct: 572 gatagagagatcaagaggcttgggaaacgacctgtgttgcaagt 615