Miyakogusa Predicted Gene

Lj3g3v1602810.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1602810.1 CUFF.42831.1
         (147 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82564 similar to UniRef100_Q1RU96 Cluster: Hemopexin;...    62   9e-10
gnl|LJGI|TC60314 similar to UniRef100_Q6Y2F4 Cluster: Ferredoxin...    62   9e-10

>gnl|LJGI|TC82564 similar to UniRef100_Q1RU96 Cluster: Hemopexin; n=1; Medicago
           truncatula|Rep: Hemopexin - Medicago truncatula (Barrel
           medic), partial (7%)
          Length = 653

 Score = 61.9 bits (31), Expect = 9e-10
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 2   tgttattgagacccacaaggagacggagctcactggttaattcaata 48
           |||||||||||| |||||||||   ||||||||||||||||||||||
Sbjct: 187 tgttattgagactcacaaggaggaagagctcactggttaattcaata 141



 Score = 54.0 bits (27), Expect = 2e-07
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 90  tctctctttctcatgtctgttacatttaattttgt 124
           |||||||||| |||||||||| |||||||||||||
Sbjct: 100 tctctctttcccatgtctgttgcatttaattttgt 66


>gnl|LJGI|TC60314 similar to UniRef100_Q6Y2F4 Cluster: Ferredoxin; n=1; Helianthus
           annuus|Rep: Ferredoxin - Helianthus annuus (Common
           sunflower), partial (86%)
          Length = 846

 Score = 61.9 bits (31), Expect = 9e-10
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 2   tgttattgagacccacaaggagacggagctcactggttaattcaata 48
           |||||||||||| |||||||||   ||||||||||||||||||||||
Sbjct: 551 tgttattgagactcacaaggaggaagagctcactggttaattcaata 597



 Score = 54.0 bits (27), Expect = 2e-07
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 90  tctctctttctcatgtctgttacatttaattttgt 124
           |||||||||| |||||||||| |||||||||||||
Sbjct: 632 tctctctttcccatgtctgttgcatttaattttgt 666