Miyakogusa Predicted Gene

Lj3g3v1541350.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1541350.1 Non Chatacterized Hit- tr|K4CX67|K4CX67_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,49.41,0.00000000000003,no description,NULL; P21-Rho-binding
domain,PAK-box/P21-Rho-binding; seg,NULL;
PBD,PAK-box/P21-Rho-b,gene.g47605.t1.1
         (426 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012720                                                     105   2e-22

>gnl|LJGI|GO012720 
          Length = 741

 Score =  105 bits (53), Expect = 2e-22
 Identities = 67/69 (97%), Gaps = 2/69 (2%)
 Strand = Plus / Plus

                                                                       
Query: 13  gttgtgaaggagagggagatggacatagggtatccaacagatgttaagcacgtggctcac 72
           ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 675 gttgtgaag-agagggagatggacatagggtatcca-cagatgttaagcacgtggctcac 732

                    
Query: 73  atcggatgg 81
           |||||||||
Sbjct: 733 atcggatgg 741