Miyakogusa Predicted Gene

Lj3g3v1528030.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1528030.1 tr|G7KSB9|G7KSB9_MEDTR TIR-NBS-LRR type disease
resistance protein OS=Medicago truncatula
GN=MTR_7g0,64.47,5e-19,seg,NULL; L domain-like,NULL; no
description,NULL; LRR_1,Leucine-rich
repeat,gene.Ljchr3_pseudomol_20120830.path1.gene3498.1
         (477 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC593321 weakly similar to UniRef100_A7QH95 Cluster: Ch...   111   4e-24

>gnl|LJGI|DC593321 weakly similar to UniRef100_A7QH95 Cluster: Chromosome chr18
           scaffold_96, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr18 scaffold_96, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (11%)
          Length = 553

 Score =  111 bits (56), Expect = 4e-24
 Identities = 86/96 (89%)
 Strand = Plus / Plus

                                                                       
Query: 3   ggagactcccaattttgatgggagccaaagacttgagcggctagactttacaggatgcac 62
           |||||| ||||||||||| || |||  |||||||||| |||||||  |||||||||||||
Sbjct: 455 ggagacccccaattttgaaggaagcagaagacttgagaggctagatcttacaggatgcac 514

                                               
Query: 63  aaacctattgcaggttcatccttcaattggacttct 98
           ||||||||||||||| ||||| ||||||||||||||
Sbjct: 515 aaacctattgcaggtccatccatcaattggacttct 550