Miyakogusa Predicted Gene
- Lj3g3v1404150.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v1404150.1 Non Chatacterized Hit- tr|J3FKZ0|J3FKZ0_9PSED
Putative deacylase OS=Pseudomonas sp. GM33 PE=3
SV=1,32.91,1.1,seg,NULL,CUFF.42558.1
(388 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC67847 127 5e-29
gnl|LJGI|TC65360 weakly similar to UniRef100_A8JIF0 Cluster: Cel... 94 8e-19
>gnl|LJGI|TC67847
Length = 894
Score = 127 bits (64), Expect = 5e-29
Identities = 73/76 (96%)
Strand = Plus / Minus
Query: 148 gggcgttttgcatgttctgtatcgccggcagtatctggttcacaaggccggtgtcattgg 207
|||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 475 gggcgttttgcacgttctgtatcgccggcagcatctggttcacgaggccggtgtcattgg 416
Query: 208 aggttatcacctcgtt 223
||||||||||||||||
Sbjct: 415 aggttatcacctcgtt 400
>gnl|LJGI|TC65360 weakly similar to UniRef100_A8JIF0 Cluster: Cell wall protein
pherophorin-C8; n=1; Chlamydomonas reinhardtii|Rep: Cell
wall protein pherophorin-C8 - Chlamydomonas reinhardtii,
partial (6%)
Length = 767
Score = 93.7 bits (47), Expect = 8e-19
Identities = 74/83 (89%)
Strand = Plus / Minus
Query: 238 attctgatctgtgcaccttcgttaattcctgtggagtaccttgcagatctggggttgcag 297
|||| |||||| |||||| | |||||||||||||||||||||||||||||||| ||| |
Sbjct: 241 attccgatctgggcacctccattaattcctgtggagtaccttgcagatctgggtttgtgg 182
Query: 298 aggtgcttgggagttgcgatggc 320
||||||| |||||||||| ||||
Sbjct: 181 aggtgctggggagttgcggtggc 159
Score = 73.8 bits (37), Expect = 7e-13
Identities = 58/65 (89%)
Strand = Plus / Minus
Query: 1 atgatgaaacccggtgctgcccctccaccttcatctaccccaaacctaaattcagcctcg 60
|||||||||||| | |||||| |||| ||||||||| |||||| |||||||| |||||||
Sbjct: 349 atgatgaaacccagcgctgccactcctccttcatcttccccaaccctaaatttagcctcg 290
Query: 61 ctgca 65
|||||
Sbjct: 289 ctgca 285