Miyakogusa Predicted Gene

Lj3g3v1403990.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1403990.1 tr|G7JJK2|G7JJK2_MEDTR Serine/threonine protein
kinase Nek9 OS=Medicago truncatula GN=MTR_4g029410
P,73.62,0,RCC1_3,Regulator of chromosome condensation, RCC1;
ZF_FYVE,Zinc finger, FYVE-related; RCC1_2,Regulat,CUFF.42543.1
         (1899 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP053036 homologue to UniRef100_A7QMY2 Cluster: Chromos...    54   3e-06

>gnl|LJGI|BP053036 homologue to UniRef100_A7QMY2 Cluster: Chromosome undetermined
           scaffold_129, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_129,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (15%)
          Length = 456

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 445 acatggggagatggtgcacataatgttggacttcttggccatggtaccgaggctagccat 504
           |||||||| |||||| | ||||| | |||||||||||| ||||| || || | ||| |||
Sbjct: 77  acatggggtgatggtactcataaagctggacttcttggtcatggaactgatgttagtcat 136

                      
Query: 505 tggataccaaa 515
           |||||||||||
Sbjct: 137 tggataccaaa 147