Miyakogusa Predicted Gene

Lj3g3v1312770.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1312770.1 tr|Q9FRW8|Q9FRW8_NEPAL Aspartic proteinase 2
OS=Nepenthes alata GN=NaAP2 PE=2 SV=1,73.25,0,no description,Peptidase
aspartic, catalytic; no description,Saposin-like; PEPSIN,Peptidase A1;
seg,,CUFF.42445.1
         (1536 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP046968 homologue to UniRef100_A7QUJ2 Cluster: Chromos...   113   3e-24
gnl|LJGI|TC58959 similar to UniRef100_Q948P0 Cluster: Aspartic p...   111   1e-23
gnl|LJGI|TC70583 similar to UniRef100_Q94IA2 Cluster: Aspartic p...    66   7e-10
gnl|LJGI|TC81793 similar to UniRef100_Q948P0 Cluster: Aspartic p...    60   4e-08

>gnl|LJGI|BP046968 homologue to UniRef100_A7QUJ2 Cluster: Chromosome chr10 scaffold_179,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr10 scaffold_179, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (5%)
          Length = 313

 Score =  113 bits (57), Expect = 3e-24
 Identities = 57/57 (100%)
 Strand = Plus / Minus

                                                                     
Query: 1480 cacacagtgtttgattatggcaacatgagagttggatttgctgaatcagcataggtc 1536
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 313  cacacagtgtttgattatggcaacatgagagttggatttgctgaatcagcataggtc 257


>gnl|LJGI|TC58959 similar to UniRef100_Q948P0 Cluster: Aspartic proteinase 2; n=1;
           Glycine max|Rep: Aspartic proteinase 2 - Glycine max
           (Soybean), complete
          Length = 1808

 Score =  111 bits (56), Expect = 1e-23
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 242 tggatgctcagtattttggtgagattggtattgggaatcctcctcagaaatttactgtga 301
           |||||||||||||||||||||||||||| ||||| |  || || ||||  |||||||| |
Sbjct: 321 tggatgctcagtattttggtgagattggaattggcacacccccacagacctttactgtca 380

                                                                       
Query: 302 tatttgacactggaagttccaacctttgggttccttcctctaagtgttatttttctgttg 361
           ||||||| ||||| || ||||||||||||||||| || || |||||||| |||||| |||
Sbjct: 381 tatttgatactggtagctccaacctttgggttccatcatcaaagtgttacttttctcttg 440

                   
Query: 362 cttgctat 369
           | ||||||
Sbjct: 441 cctgctat 448


>gnl|LJGI|TC70583 similar to UniRef100_Q94IA2 Cluster: Aspartic proteinase 1; n=1;
            Glycine max|Rep: Aspartic proteinase 1 - Glycine max
            (Soybean), partial (36%)
          Length = 744

 Score = 65.9 bits (33), Expect = 7e-10
 Identities = 141/177 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1358 agtacattcttaaagtgggaaaaggagctacagcacagtgcattagtggattcatagctt 1417
            ||||||| || ||||||||| ||||  || | || ||||||||||| || || |  ||| 
Sbjct: 389  agtacatactcaaagtgggagaaggtcctgcggctcagtgcattagcggctttactgcta 448

                                                                        
Query: 1418 tagacattgctcctcctcgtggacctctatggattctgggggacattttcatgggaaggt 1477
            | || ||| ||||||| ||||||||||| ||||| || || ||  | ||||||||  | |
Sbjct: 449  tggatattcctcctccacgtggacctctctggatccttggagatgtgttcatggggcgtt 508

                                                                     
Query: 1478 atcacacagtgtttgattatggcaacatgagagttggatttgctgaatcagcatagg 1534
            |||||||||| ||||||| ||| ||   |||||||||||||||| || |||||||||
Sbjct: 509  atcacacagtctttgattttggtaaatcgagagttggatttgctaaagcagcatagg 565


>gnl|LJGI|TC81793 similar to UniRef100_Q948P0 Cluster: Aspartic proteinase 2; n=1;
           Glycine max|Rep: Aspartic proteinase 2 - Glycine max
           (Soybean), partial (18%)
          Length = 400

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 242 tggatgctcagtattttggtgagattggtattgg 275
           |||||||||||||||||||||||||||| |||||
Sbjct: 362 tggatgctcagtattttggtgagattggaattgg 395