Miyakogusa Predicted Gene
- Lj3g3v1312770.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v1312770.1 tr|Q9FRW8|Q9FRW8_NEPAL Aspartic proteinase 2
OS=Nepenthes alata GN=NaAP2 PE=2 SV=1,73.25,0,no description,Peptidase
aspartic, catalytic; no description,Saposin-like; PEPSIN,Peptidase A1;
seg,,CUFF.42445.1
(1536 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP046968 homologue to UniRef100_A7QUJ2 Cluster: Chromos... 113 3e-24
gnl|LJGI|TC58959 similar to UniRef100_Q948P0 Cluster: Aspartic p... 111 1e-23
gnl|LJGI|TC70583 similar to UniRef100_Q94IA2 Cluster: Aspartic p... 66 7e-10
gnl|LJGI|TC81793 similar to UniRef100_Q948P0 Cluster: Aspartic p... 60 4e-08
>gnl|LJGI|BP046968 homologue to UniRef100_A7QUJ2 Cluster: Chromosome chr10 scaffold_179,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr10 scaffold_179, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (5%)
Length = 313
Score = 113 bits (57), Expect = 3e-24
Identities = 57/57 (100%)
Strand = Plus / Minus
Query: 1480 cacacagtgtttgattatggcaacatgagagttggatttgctgaatcagcataggtc 1536
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 313 cacacagtgtttgattatggcaacatgagagttggatttgctgaatcagcataggtc 257
>gnl|LJGI|TC58959 similar to UniRef100_Q948P0 Cluster: Aspartic proteinase 2; n=1;
Glycine max|Rep: Aspartic proteinase 2 - Glycine max
(Soybean), complete
Length = 1808
Score = 111 bits (56), Expect = 1e-23
Identities = 110/128 (85%)
Strand = Plus / Plus
Query: 242 tggatgctcagtattttggtgagattggtattgggaatcctcctcagaaatttactgtga 301
|||||||||||||||||||||||||||| ||||| | || || |||| |||||||| |
Sbjct: 321 tggatgctcagtattttggtgagattggaattggcacacccccacagacctttactgtca 380
Query: 302 tatttgacactggaagttccaacctttgggttccttcctctaagtgttatttttctgttg 361
||||||| ||||| || ||||||||||||||||| || || |||||||| |||||| |||
Sbjct: 381 tatttgatactggtagctccaacctttgggttccatcatcaaagtgttacttttctcttg 440
Query: 362 cttgctat 369
| ||||||
Sbjct: 441 cctgctat 448
>gnl|LJGI|TC70583 similar to UniRef100_Q94IA2 Cluster: Aspartic proteinase 1; n=1;
Glycine max|Rep: Aspartic proteinase 1 - Glycine max
(Soybean), partial (36%)
Length = 744
Score = 65.9 bits (33), Expect = 7e-10
Identities = 141/177 (79%)
Strand = Plus / Plus
Query: 1358 agtacattcttaaagtgggaaaaggagctacagcacagtgcattagtggattcatagctt 1417
||||||| || ||||||||| |||| || | || ||||||||||| || || | |||
Sbjct: 389 agtacatactcaaagtgggagaaggtcctgcggctcagtgcattagcggctttactgcta 448
Query: 1418 tagacattgctcctcctcgtggacctctatggattctgggggacattttcatgggaaggt 1477
| || ||| ||||||| ||||||||||| ||||| || || || | |||||||| | |
Sbjct: 449 tggatattcctcctccacgtggacctctctggatccttggagatgtgttcatggggcgtt 508
Query: 1478 atcacacagtgtttgattatggcaacatgagagttggatttgctgaatcagcatagg 1534
|||||||||| ||||||| ||| || |||||||||||||||| || |||||||||
Sbjct: 509 atcacacagtctttgattttggtaaatcgagagttggatttgctaaagcagcatagg 565
>gnl|LJGI|TC81793 similar to UniRef100_Q948P0 Cluster: Aspartic proteinase 2; n=1;
Glycine max|Rep: Aspartic proteinase 2 - Glycine max
(Soybean), partial (18%)
Length = 400
Score = 60.0 bits (30), Expect = 4e-08
Identities = 33/34 (97%)
Strand = Plus / Plus
Query: 242 tggatgctcagtattttggtgagattggtattgg 275
|||||||||||||||||||||||||||| |||||
Sbjct: 362 tggatgctcagtattttggtgagattggaattgg 395