Miyakogusa Predicted Gene

Lj3g3v1295880.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1295880.1 tr|G7IRH1|G7IRH1_MEDTR Ubiquitin
carboxyl-terminal hydrolase OS=Medicago truncatula GN=MTR_2g087710
,81.53,0,Cysteine proteinases,NULL; UCH,Peptidase C19, ubiquitin
carboxyl-terminal hydrolase 2; SUBFAMILY NOT,CUFF.42442.1
         (1383 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64823 similar to UniRef100_A7PGA8 Cluster: Ubiquitin ...   337   1e-91
gnl|LJGI|TC75030 weakly similar to UniRef100_A7PGA8 Cluster: Ubi...    52   9e-06

>gnl|LJGI|TC64823 similar to UniRef100_A7PGA8 Cluster: Ubiquitin carboxyl-terminal
            hydrolase; n=1; Vitis vinifera|Rep: Ubiquitin
            carboxyl-terminal hydrolase - Vitis vinifera (Grape),
            partial (7%)
          Length = 730

 Score =  337 bits (170), Expect = 1e-91
 Identities = 170/170 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1214 atggaagcatgggaggtggtcattatactgcatttgtccatcatggtggtgatcaatggt 1273
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    atggaagcatgggaggtggtcattatactgcatttgtccatcatggtggtgatcaatggt 60

                                                                        
Query: 1274 atgactttgatgatagccgtgtttatcccatcagcaaggagaagataaagtcttcagctg 1333
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   atgactttgatgatagccgtgtttatcccatcagcaaggagaagataaagtcttcagctg 120

                                                              
Query: 1334 cctatgttttgttctatagaagagtttttgaagtatcaacagaatgatag 1383
            ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121  cctatgttttgttctatagaagagtttttgaagtatcaacagaatgatag 170


>gnl|LJGI|TC75030 weakly similar to UniRef100_A7PGA8 Cluster: Ubiquitin
            carboxyl-terminal hydrolase; n=1; Vitis vinifera|Rep:
            Ubiquitin carboxyl-terminal hydrolase - Vitis vinifera
            (Grape), partial (16%)
          Length = 667

 Score = 52.0 bits (26), Expect = 9e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1223 tgggaggtggtcattatactgcatttgtcc 1252
            ||||||||||||||||||| ||||||||||
Sbjct: 186  tgggaggtggtcattatacagcatttgtcc 215