Miyakogusa Predicted Gene

Lj3g3v1294420.3
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1294420.3 tr|A9U522|A9U522_PHYPA Predicted protein
(Fragment) OS=Physcomitrella patens subsp. patens
GN=PHYPAD,51.79,3e-18,Kelch_4,NULL; Kelch_2,Kelch repeat type 2; no
description,Kelch-type beta propeller; seg,NULL; KELCH,CUFF.42406.3
         (1677 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78314 similar to UniRef100_Q9SHS7 Cluster: Serine/thr...   690   0.0  
gnl|LJGI|TC71295 similar to UniRef100_A7QVR2 Cluster: Serine/thr...   234   1e-60
gnl|LJGI|AV777443 homologue to UniRef100_A3AKU8 Cluster: Serine/...   125   1e-27
gnl|LJGI|TC72697 similar to UniRef100_A7PU12 Cluster: Serine/thr...    64   3e-09

>gnl|LJGI|TC78314 similar to UniRef100_Q9SHS7 Cluster: Serine/threonine-protein
           phosphatase BSL3; n=1; Arabidopsis thaliana|Rep:
           Serine/threonine-protein phosphatase BSL3 - Arabidopsis
           thaliana (Mouse-ear cress), partial (7%)
          Length = 549

 Score =  690 bits (348), Expect = 0.0
 Identities = 354/356 (99%)
 Strand = Plus / Plus

                                                                       
Query: 60  aggaattctagctcgatcttcacggaattcctcgaatcttagggttgaaccaatggatgt 119
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 194 aggaattctagctcgatcttcacggaattcctcgaatcttagggttgaaccaatggatgt 253

                                                                       
Query: 120 tgattcctcgatggtgccggacgccgatcacgatccagctacagagaatcacgccgcggc 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 254 tgattcctcgatggtgccggacgccgatcacgatccagctacagagaatcacgccgcggc 313

                                                                       
Query: 180 tgaggaagacggagagaagcttccagagcctccgtcatccgagggtggatctccggcgca 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 314 tgaggaagacggagagaagcttccagagcctccgtcatccgagggtggatctccggcgca 373

                                                                       
Query: 240 gccacagagctcggtggttgggccgaggctggcgccaacttatactgtggtgaatgcggt 299
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 374 gccacacagctcggtggttgggccgaggctggcgccaacttatactgtggtgaatgcggt 433

                                                                       
Query: 300 tatggataagaaggaggacgggccggggtcgaggtgcggccacacgttgacggctgtggc 359
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 434 tatggataagaaggaggacgggccggggtcgaggtgcggccacacgttgacggctgtggc 493

                                                                   
Query: 360 ggcggtcggagaggaggggacgccggggtatattggtccgaggctgattttgttcg 415
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 494 agcggtcggagaggaggggacgccggggtatattggtccgaggctgattttgttcg 549


>gnl|LJGI|TC71295 similar to UniRef100_A7QVR2 Cluster: Serine/threonine protein
           phosphatase; n=1; Vitis vinifera|Rep: Serine/threonine
           protein phosphatase - Vitis vinifera (Grape), partial
           (9%)
          Length = 721

 Score =  234 bits (118), Expect = 1e-60
 Identities = 202/230 (87%)
 Strand = Plus / Plus

                                                                       
Query: 256 gttgggccgaggctggcgccaacttatactgtggtgaatgcggttatggataagaaggag 315
           ||||| |||||||| ||||| ||||| || |||||| ||||| |||| || |||||||| 
Sbjct: 480 gttggcccgaggcttgcgccgacttacaccgtggtggatgcgattatagagaagaaggat 539

                                                                       
Query: 316 gacgggccggggtcgaggtgcggccacacgttgacggctgtggcggcggtcggagaggag 375
           |||||||| ||| || |||| || |||||||||||||| |||||||| || |||||||| 
Sbjct: 540 gacgggcccgggccgcggtgtggacacacgttgacggcggtggcggctgttggagaggaa 599

                                                                       
Query: 376 gggacgccggggtatattggtccgaggctgattttgttcggtggtgccactgcgcttgaa 435
           || ||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 600 ggcacgccggggtacattggtccgaggctgattttgttcggcggtgccacggcgcttgaa 659

                                                             
Query: 436 ggcaattctgcggcttcagggactccttcttctgctggaaatgctggcat 485
           || ||||||| |||||| ||||||||||| |||||||||||||| |||||
Sbjct: 660 gggaattctggggcttccgggactccttcatctgctggaaatgcaggcat 709


>gnl|LJGI|AV777443 homologue to UniRef100_A3AKU8 Cluster: Serine/threonine protein
           phosphatase; n=1; Oryza sativa Japonica Group|Rep:
           Serine/, partial (2%)
          Length = 597

 Score =  125 bits (63), Expect = 1e-27
 Identities = 63/63 (100%)
 Strand = Plus / Minus

                                                                       
Query: 488 gtttggctggtgccacggctgatgtccactgttatgatgtcttgactaataaatggtcta 547
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 159 gtttggctggtgccacggctgatgtccactgttatgatgtcttgactaataaatggtcta 100

              
Query: 548 ggt 550
           |||
Sbjct: 99  ggt 97


>gnl|LJGI|TC72697 similar to UniRef100_A7PU12 Cluster: Serine/threonine protein
           phosphatase; n=1; Vitis vinifera|Rep: Serine/threonine
           protein phosphatase - Vitis vinifera (Grape), partial
           (15%)
          Length = 715

 Score = 63.9 bits (32), Expect = 3e-09
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 604 gttggtaccatggttgttattcagggtggcattggtcctgctgg 647
           |||||||||||||| ||| |||||||||| ||||||||||||||
Sbjct: 614 gttggtaccatggtcgtttttcagggtgggattggtcctgctgg 657