Miyakogusa Predicted Gene

Lj3g3v1238910.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1238910.1 tr|I1MQL2|I1MQL2_SOYBN Sucrose synthase
OS=Glycine max GN=Gma.30286 PE=3
SV=1,79.72,0,UDP-Glycosyltransferase/glycogen phosphorylase,NULL;
Sucrose_synth,Sucrose synthase; Glycos_transf_1,CUFF.42392.1
         (2331 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO036318 similar to UniRef100_A7QK05 Cluster: Chromosom...   198   1e-49
gnl|LJGI|TC77381 homologue to UniRef100_P13708 Cluster: Sucrose ...    78   3e-13
gnl|LJGI|BW625229 homologue to UniRef100_P13708 Cluster: Sucrose...    62   2e-08

>gnl|LJGI|GO036318 similar to UniRef100_A7QK05 Cluster: Chromosome undetermined
            scaffold_109, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome undetermined scaffold_109, whole
            genome shotgun sequence - Vitis vinifera (Grape), partial
            (28%)
          Length = 796

 Score =  198 bits (100), Expect = 1e-49
 Identities = 244/292 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1499 aacacaaactccagggtcaattcaggtggattgcagcgcagaccgatcggtaccgcaacg 1558
            ||||| ||||| |||| |||||||| |||||||| ||||||||  |||| |||||||| |
Sbjct: 220  aacaccaactcaagggccaattcagatggattgctgcgcagactaatcgataccgcaatg 279

                                                                        
Query: 1559 gagagctctaccggtgcattgcggacacaaagggagcttttgtgcaaccagcattgtatg 1618
            | ||||||||||| |||||||| ||| ||||||||||||||||||| || ||  ||||||
Sbjct: 280  gtgagctctaccgttgcattgctgactcaaagggagcttttgtgcagcctgctatgtatg 339

                                                                        
Query: 1619 aggcctttggcctcacagtcattgaggccatgaactgtggattacctacttttgcaacaa 1678
            | || ||||| || || |||||||| || ||||||||||| || || |||||||| || |
Sbjct: 340  aagcatttggactaactgtcattgaagcaatgaactgtggcttgcccacttttgctacca 399

                                                                        
Query: 1679 atcaaggtggcccagcagagattctagttgatggggtctcaggttttcatattgatatcc 1738
            |||||||||| ||||| || ||  | |||||||||||||| || || || |||||    |
Sbjct: 400  atcaaggtggtccagctgaaatcattgttgatggggtctctggcttccacattgaccctc 459

                                                                
Query: 1739 acaatggaaatgaatcaagcaacaagattgctgatttctttgagaagtgcaa 1790
             ||||||| |||||||||||||||| ||||||||||||||||| || |||||
Sbjct: 460  tcaatggagatgaatcaagcaacaaaattgctgatttctttgaaaaatgcaa 511


>gnl|LJGI|TC77381 homologue to UniRef100_P13708 Cluster: Sucrose synthase; n=1; Glycine
            max|Rep: Sucrose synthase - Glycine max (Soybean),
            partial (90%)
          Length = 2282

 Score = 77.8 bits (39), Expect = 3e-13
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                        
Query: 964  aagtatcacttttcaagtcagttcacagctgacctaattgcaatgaatgctgctgatttc 1023
            ||||||||||| ||| | || || |||||||| ||  |||||||||||    |||| |||
Sbjct: 1425 aagtatcacttctcatgccaatttacagctgatctctttgcaatgaatcacactgacttc 1484

                                                                        
Query: 1024 atcataactagcacattccaagagattgcaggaagcaaggataggccaggacagtatgaa 1083
            ||||| || || ||||||||||||||||| |||||||||||||    |||||||||||| 
Sbjct: 1485 atcatcaccagtacattccaagagattgctggaagcaaggatactgtaggacagtatgag 1544

                       
Query: 1084 acccacactgc 1094
            | |||||||||
Sbjct: 1545 agccacactgc 1555


>gnl|LJGI|BW625229 homologue to UniRef100_P13708 Cluster: Sucrose synthase; n=1; Glycine
            max|Rep: Sucrose synthase - Glycine max (Soybean),
            partial (19%)
          Length = 515

 Score = 61.9 bits (31), Expect = 2e-08
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1016 ctgatttcatcataactagcacattccaagagattgcaggaagcaaggataggccaggac 1075
            |||| |||||||| || || ||||||||||||||||| |||||||||||||    |||||
Sbjct: 65   ctgacttcatcatcaccagtacattccaagagattgctggaagcaaggatactgtaggac 124

                   
Query: 1076 agtatga 1082
            |||||||
Sbjct: 125  agtatga 131