Miyakogusa Predicted Gene
- Lj3g3v1238910.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v1238910.1 tr|I1MQL2|I1MQL2_SOYBN Sucrose synthase
OS=Glycine max GN=Gma.30286 PE=3
SV=1,79.72,0,UDP-Glycosyltransferase/glycogen phosphorylase,NULL;
Sucrose_synth,Sucrose synthase; Glycos_transf_1,CUFF.42392.1
(2331 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO036318 similar to UniRef100_A7QK05 Cluster: Chromosom... 198 1e-49
gnl|LJGI|TC77381 homologue to UniRef100_P13708 Cluster: Sucrose ... 78 3e-13
gnl|LJGI|BW625229 homologue to UniRef100_P13708 Cluster: Sucrose... 62 2e-08
>gnl|LJGI|GO036318 similar to UniRef100_A7QK05 Cluster: Chromosome undetermined
scaffold_109, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_109, whole
genome shotgun sequence - Vitis vinifera (Grape), partial
(28%)
Length = 796
Score = 198 bits (100), Expect = 1e-49
Identities = 244/292 (83%)
Strand = Plus / Plus
Query: 1499 aacacaaactccagggtcaattcaggtggattgcagcgcagaccgatcggtaccgcaacg 1558
||||| ||||| |||| |||||||| |||||||| |||||||| |||| |||||||| |
Sbjct: 220 aacaccaactcaagggccaattcagatggattgctgcgcagactaatcgataccgcaatg 279
Query: 1559 gagagctctaccggtgcattgcggacacaaagggagcttttgtgcaaccagcattgtatg 1618
| ||||||||||| |||||||| ||| ||||||||||||||||||| || || ||||||
Sbjct: 280 gtgagctctaccgttgcattgctgactcaaagggagcttttgtgcagcctgctatgtatg 339
Query: 1619 aggcctttggcctcacagtcattgaggccatgaactgtggattacctacttttgcaacaa 1678
| || ||||| || || |||||||| || ||||||||||| || || |||||||| || |
Sbjct: 340 aagcatttggactaactgtcattgaagcaatgaactgtggcttgcccacttttgctacca 399
Query: 1679 atcaaggtggcccagcagagattctagttgatggggtctcaggttttcatattgatatcc 1738
|||||||||| ||||| || || | |||||||||||||| || || || ||||| |
Sbjct: 400 atcaaggtggtccagctgaaatcattgttgatggggtctctggcttccacattgaccctc 459
Query: 1739 acaatggaaatgaatcaagcaacaagattgctgatttctttgagaagtgcaa 1790
||||||| |||||||||||||||| ||||||||||||||||| || |||||
Sbjct: 460 tcaatggagatgaatcaagcaacaaaattgctgatttctttgaaaaatgcaa 511
>gnl|LJGI|TC77381 homologue to UniRef100_P13708 Cluster: Sucrose synthase; n=1; Glycine
max|Rep: Sucrose synthase - Glycine max (Soybean),
partial (90%)
Length = 2282
Score = 77.8 bits (39), Expect = 3e-13
Identities = 108/131 (82%)
Strand = Plus / Plus
Query: 964 aagtatcacttttcaagtcagttcacagctgacctaattgcaatgaatgctgctgatttc 1023
||||||||||| ||| | || || |||||||| || ||||||||||| |||| |||
Sbjct: 1425 aagtatcacttctcatgccaatttacagctgatctctttgcaatgaatcacactgacttc 1484
Query: 1024 atcataactagcacattccaagagattgcaggaagcaaggataggccaggacagtatgaa 1083
||||| || || ||||||||||||||||| ||||||||||||| ||||||||||||
Sbjct: 1485 atcatcaccagtacattccaagagattgctggaagcaaggatactgtaggacagtatgag 1544
Query: 1084 acccacactgc 1094
| |||||||||
Sbjct: 1545 agccacactgc 1555
>gnl|LJGI|BW625229 homologue to UniRef100_P13708 Cluster: Sucrose synthase; n=1; Glycine
max|Rep: Sucrose synthase - Glycine max (Soybean),
partial (19%)
Length = 515
Score = 61.9 bits (31), Expect = 2e-08
Identities = 58/67 (86%)
Strand = Plus / Plus
Query: 1016 ctgatttcatcataactagcacattccaagagattgcaggaagcaaggataggccaggac 1075
|||| |||||||| || || ||||||||||||||||| ||||||||||||| |||||
Sbjct: 65 ctgacttcatcatcaccagtacattccaagagattgctggaagcaaggatactgtaggac 124
Query: 1076 agtatga 1082
|||||||
Sbjct: 125 agtatga 131