Miyakogusa Predicted Gene

Lj3g3v1145890.2

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1145890.2 Non Chatacterized Hit- tr|F6HHH5|F6HHH5_VITVI
Putative uncharacterized protein OS=Vitis vinifera GN=,35.92,7e-16,
,CUFF.42295.2
         (474 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70464                                                      341   2e-93
gnl|LJGI|AV777423 similar to UniRef100_A7UU57 Cluster: AGAP00621...   145   3e-34

>gnl|LJGI|TC70464 
          Length = 533

 Score =  341 bits (172), Expect = 2e-93
 Identities = 286/324 (88%)
 Strand = Plus / Plus

                                                                       
Query: 151 atagaaagttatttggctgatgttgatgtgatcctttctgaacttgctcgccatgttgat 210
           ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||
Sbjct: 1   atagaaagttatttggctgatgttgatgtgatcctgtctgaactttctcgccatgttgat 60

                                                                       
Query: 211 aattcgcaagttgacttctctatgttggcttccctagctcgtgaagtacatgataagagc 270
           ||||| || |||||||||| |||||||| |||||||||||||||||||||||||||||||
Sbjct: 61  aattcacatgttgacttctatatgttgggttccctagctcgtgaagtacatgataagagc 120

                                                                       
Query: 271 acaagcattggcacagagcacatgaggcttgcaagtttggatgtcattacagcttgtgat 330
           |||||||||||  |||| || |||||||||||| |||| ||||||||| |||||||||||
Sbjct: 121 acaagcattggtgcagatcatatgaggcttgcatgttttgatgtcattgcagcttgtgat 180

                                                                       
Query: 331 gacaggcgcaaattaagatttgatcacaccctgccccttctgaacagtgagtttgaatac 390
           || ||| |||||   || |||  ||||| |||| |||| ||||| | |||||| |  || 
Sbjct: 181 gagaggtgcaaaagcagtttttctcacaacctgaccctactgaaaaatgagttcggttat 240

                                                                       
Query: 391 actaggaggcagttgagctactttgttcggctggagagggatgttatcagacttgaggag 450
           |||| ||||||||||||| | ||||||| | ||||||||||| |||||||||||||||||
Sbjct: 241 actaagaggcagttgagcaattttgttcagttggagagggatattatcagacttgaggag 300

                                   
Query: 451 aattctcaaccaccgaactagagt 474
           | |||||||||||| |||||||||
Sbjct: 301 agttctcaaccaccaaactagagt 324


>gnl|LJGI|AV777423 similar to UniRef100_A7UU57 Cluster: AGAP006216-PA; n=1; Anopheles
           gambiae str. PEST|Rep: AGAP006216-PA - Anopheles gambiae
           str. PEST, partial (3%)
          Length = 597

 Score =  145 bits (73), Expect = 3e-34
 Identities = 169/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 274 agcattggcacagagcacatgaggcttgcaagtttggatgtcattacagcttgtgatgac 333
           ||||||||  |||| || |||||||||||| |||| ||||||||| ||||||||||||| 
Sbjct: 405 agcattggtgcagatcatatgaggcttgcatgttttgatgtcattgcagcttgtgatgag 346

                                                                       
Query: 334 aggcgcaaattaagatttgatcacaccctgccccttctgaacagtgagtttgaatacact 393
           ||| |||||   || |||  ||||| |||| |||| ||||| | |||||| |  || |||
Sbjct: 345 aggtgcaaaagcagtttttctcacaacctgaccctactgaaaaatgagttcggttatact 286

                                                                       
Query: 394 aggaggcagttgagctactttgttcggctggagagggatgttatcagacttgaggagaat 453
           | ||||||||||||| | ||||||| | ||||||||||| |||||||||||||||||| |
Sbjct: 285 aagaggcagttgagcaattttgttcagttggagagggatattatcagacttgaggagagt 226

                                
Query: 454 tctcaaccaccgaactagagt 474
           ||||||||||| |||||||||
Sbjct: 225 tctcaaccaccaaactagagt 205