Miyakogusa Predicted Gene
- Lj3g3v1132370.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v1132370.1 tr|F8EQY8|F8EQY8_RUNSL Bacteroides conjugation
system ATPase, TraG family OS=Runella slithyformis (s,35.71,5.2,
,CUFF.42275.1
(201 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75772 similar to UniRef100_A5BHQ5 Cluster: Ubiquitin ... 311 9e-85
gnl|LJGI|TC57853 similar to UniRef100_A5BHQ5 Cluster: Ubiquitin ... 105 1e-22
>gnl|LJGI|TC75772 similar to UniRef100_A5BHQ5 Cluster: Ubiquitin carrier protein;
n=1; Vitis vinifera|Rep: Ubiquitin carrier protein -
Vitis vinifera (Grape), partial (43%)
Length = 538
Score = 311 bits (157), Expect = 9e-85
Identities = 190/201 (94%)
Strand = Plus / Plus
Query: 1 atgattacctttttaagcctccaaaagtcaaatttgaattcacctgcttcaatcccaatc 60
|||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 58 atgactacctttttaagcctcccaaagtcaaatttgaattcacctgcttcgatcccaatc 117
Query: 61 acaatgctgatgtgcatggcaacatatgctcggaaatacttctggataagtggtcatatg 120
|| ||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||
Sbjct: 118 accatgctgatgtgcatggccacatatgcttggaaatagttctggataagtggtcatatg 177
Query: 121 catatgatgtcactgtcagagcaattctattatctatccaaagtctacttggagagccaa 180
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
Sbjct: 178 catatgatgtcactgtcagagccattctattatctatcccaagtctacttggagagccca 237
Query: 181 atatttgttcacaactaaatc 201
|||||||||||| ||||||||
Sbjct: 238 atatttgttcacgactaaatc 258
>gnl|LJGI|TC57853 similar to UniRef100_A5BHQ5 Cluster: Ubiquitin carrier protein;
n=1; Vitis vinifera|Rep: Ubiquitin carrier protein -
Vitis vinifera (Grape), partial (90%)
Length = 882
Score = 105 bits (53), Expect = 1e-22
Identities = 118/140 (84%), Gaps = 6/140 (4%)
Strand = Plus / Plus
Query: 62 caatgctgatgtgcatggcaacatatgctcggaaatacttctggataagtggtcatatgc 121
||||| |||||| || ||||||||||||| ||| ||||||| |||||||||||| | |||
Sbjct: 463 caatgttgatgtccaaggcaacatatgcttggacatacttcaggataagtggtcctctgc 522
Query: 122 atatgatgtcactgtcagagcaattctattatctatccaaagtctacttggagagccaaa 181
||||||||| | | ||||||| ||||| ||||||||||| ||||||||||||||
Sbjct: 523 atatgatgtga------ggacaattctgttatccatccaaagtctgcttggagagccaaa 576
Query: 182 tatttgttcacaactaaatc 201
|||| |||||| ||||||||
Sbjct: 577 tattagttcaccactaaatc 596