Miyakogusa Predicted Gene

Lj3g3v1101730.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1101730.1 tr|I9N6R7|I9N6R7_RHILT ABC-type branched-chain
amino acid transport system, periplasmic component (P,31.76,1.5,
,CUFF.42192.1
         (486 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW621010 similar to UniRef100_Q2HTN3 Cluster: Zinc fing...   105   3e-22
gnl|LJGI|TC74246 similar to UniRef100_Q2HTN3 Cluster: Zinc finge...   105   3e-22

>gnl|LJGI|BW621010 similar to UniRef100_Q2HTN3 Cluster: Zinc finger, RING-type; n=1;
           Medicago truncatula|Rep: Zinc finger, RING-type -
           Medicago truncatula (Barrel medic), partial (31%)
          Length = 543

 Score =  105 bits (53), Expect = 3e-22
 Identities = 125/149 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 cctccgagagcgtgcgtgggtgatgggcaggacgttgttagtgttcgaatcggcacactg 336
           |||||| ||||| |||||||||||||| |||||| |||| | ||| |||||||| |||||
Sbjct: 315 cctccgggagcgcgcgtgggtgatggggaggacgctgttggggtttgaatcggcgcactg 256

                                                                       
Query: 337 acagatgtagatggagaacaggcccatgaggaaaagagcaaagaccaacatgacaaagat 396
           || ||||||||||||||| | |||||||||||| ||||||  ||| |  ||||| | |||
Sbjct: 255 acggatgtagatggagaagaagcccatgaggaagagagcagcgacgagtatgacgatgat 196

                                        
Query: 397 tatggcgaaggaggggttgaattcgttga 425
           ||| || || || ||||||||||| ||||
Sbjct: 195 tatagcaaacgaagggttgaattctttga 167


>gnl|LJGI|TC74246 similar to UniRef100_Q2HTN3 Cluster: Zinc finger, RING-type; n=1;
           Medicago truncatula|Rep: Zinc finger, RING-type -
           Medicago truncatula (Barrel medic), partial (81%)
          Length = 1559

 Score =  105 bits (53), Expect = 3e-22
 Identities = 125/149 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 cctccgagagcgtgcgtgggtgatgggcaggacgttgttagtgttcgaatcggcacactg 336
           |||||| ||||| |||||||||||||| |||||| |||| | ||| |||||||| |||||
Sbjct: 426 cctccgggagcgcgcgtgggtgatggggaggacgctgttggggtttgaatcggcgcactg 367

                                                                       
Query: 337 acagatgtagatggagaacaggcccatgaggaaaagagcaaagaccaacatgacaaagat 396
           || ||||||||||||||| | |||||||||||| ||||||  ||| |  ||||| | |||
Sbjct: 366 acggatgtagatggagaagaagcccatgaggaagagagcagcgacgagtatgacgatgat 307

                                        
Query: 397 tatggcgaaggaggggttgaattcgttga 425
           ||| || || || ||||||||||| ||||
Sbjct: 306 tatagcaaacgaagggttgaattctttga 278