Miyakogusa Predicted Gene

Lj3g3v1061180.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1061180.1 Non Chatacterized Hit- tr|A5AE46|A5AE46_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,62.34,6e-19,seg,NULL; Galactosyl_T,Glycosyl transferase, family
31; BETA 1,3-GLYCOSYLTRANSFERASE-LIKE PROTEIN II,CUFF.42093.1
         (558 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV776288 similar to UniRef100_Q9MAH2 Cluster: F12M16.19...   613   e-175
gnl|LJGI|TC72432 similar to UniRef100_A7P1Y7 Cluster: Chromosome...   174   4e-43
gnl|LJGI|DC594953 similar to UniRef100_Q9MAH2 Cluster: F12M16.19...    82   4e-15

>gnl|LJGI|AV776288 similar to UniRef100_Q9MAH2 Cluster: F12M16.19; n=1; Arabidopsis
           thaliana|Rep: F12M16.19 - Arabidopsis thaliana
           (Mouse-ear cress), partial (43%)
          Length = 559

 Score =  613 bits (309), Expect = e-175
 Identities = 334/341 (97%), Gaps = 1/341 (0%)
 Strand = Plus / Plus

                                                                       
Query: 163 cctagatcggttcgcgtgctctgggaccatggccctacctccctccgcgaccacctcaat 222
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29  cctagatcggttcgcgtgctctgggaccatggccctacctccctccgcgaccacctcaat 88

                                                                       
Query: 223 gttgctgatactgataggcataaagtcatggcgtttgttggcattcaaaccgggttcgga 282
           |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||
Sbjct: 89  gttgctgatactgataggcataaagtcatggcgtgtgttggcattcagaccgggttcgga 148

                                                                       
Query: 283 tccgtcggtaggcgccaatctttgaggaagacttggtttccttccgatccgaatggactc 342
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149 tccgtcggtaggcgccaatctttgaggaagacttggtttccttccgatccgaatggactc 208

                                                                       
Query: 343 cagcgcctggaagaa-tccactggcttggcttttaggtttgttattggaagaacgagtga 401
           ||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 209 cagcgcctgaaagaagtccactggcttggcttttaggtttgtgattggaagaacgagtga 268

                                                                       
Query: 402 tagatcaaagatgtctgtgcttaaaagggaagtagcagaatatgatgatttcattcaatt 461
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 269 tagatcaaagatgtctgtgcttaaaagggaagtagcagaatatgatgatttcatgcaatt 328

                                                    
Query: 462 ggatattgaagaggagtacagtaagctcccatacaaaacgt 502
           |||||| ||||||||||||||||||||||||||||||||||
Sbjct: 329 ggatatggaagaggagtacagtaagctcccatacaaaacgt 369


>gnl|LJGI|TC72432 similar to UniRef100_A7P1Y7 Cluster: Chromosome chr19 scaffold_4,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr19 scaffold_4, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (36%)
          Length = 482

 Score =  174 bits (88), Expect = 4e-43
 Identities = 190/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 235 gataggcataaagtcatggcgtttgttggcattcaaaccgggttcggatccgtcggtagg 294
           ||||||||||| || ||||  ||||| || |||||||| ||||| ||||| || ||||||
Sbjct: 259 gataggcataaggtgatgggttttgtgggaattcaaactgggtttggatctgttggtagg 318

                                                                       
Query: 295 cgccaatctttgaggaagacttggtttccttccgatccgaatggactccagcgcctggaa 354
            | ||||| |||||||||||||||||||| |||||||   | || || || ||| |||||
Sbjct: 319 agacaatcgttgaggaagacttggtttccctccgatcgccaaggccttcaacgcttggaa 378

                                                                       
Query: 355 gaatccactggcttggcttttaggtttgttattggaagaacgagtgatagatcaaagatg 414
           ||| ||||||| ||||||||||||||||| ||||| ||||| ||||||| | ||||||||
Sbjct: 379 gaagccactgggttggcttttaggtttgtcattggtagaacaagtgatacagcaaagatg 438

                                                       
Query: 415 tctgtgcttaaaagggaagtagcagaatatgatgatttcattca 458
           |||| |||| | | |||||| |||||||||||||||||||||||
Sbjct: 439 tctgcgcttcagaaggaagttgcagaatatgatgatttcattca 482


>gnl|LJGI|DC594953 similar to UniRef100_Q9MAH2 Cluster: F12M16.19; n=1; Arabidopsis
           thaliana|Rep: F12M16.19 - Arabidopsis thaliana
           (Mouse-ear cress), partial (16%)
          Length = 436

 Score = 81.8 bits (41), Expect = 4e-15
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                       
Query: 235 gataggcataaagtcatggcgtttgttggcattcaaaccgggttcggatccgtcggtagg 294
           ||||||||||| || ||||  ||||| || |||||||| ||||| ||||| || ||||||
Sbjct: 297 gataggcataaggtgatgggttttgtgggaattcaaactgggtttggatctgttggtagg 356

                                                
Query: 295 cgccaatctttgaggaagacttggtttccttccgatc 331
            | ||||| |||||||||||||||||||| |||||||
Sbjct: 357 agacaatcgttgaggaagacttggtttccctccgatc 393