Miyakogusa Predicted Gene

Lj3g3v1038840.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1038840.1 Non Chatacterized Hit- tr|B7FLZ9|B7FLZ9_MEDTR
Putative uncharacterized protein OS=Medicago truncatul,85.92,0,no
description,NULL; PROTEIN_KINASE_ATP,Protein kinase, ATP binding site;
PROTEIN_KINASE_ST,Serine/t,CUFF.42053.1
         (1071 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62983                                                       56   5e-07

>gnl|LJGI|TC62983 
          Length = 695

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 766 gatgtttacagctttggagttgtgttactggagcttttaacagg 809
           |||||||| ||||||||||||||||| || ||| ||||||||||
Sbjct: 274 gatgtttatagctttggagttgtgttgcttgagattttaacagg 317