Miyakogusa Predicted Gene

Lj3g3v1036620.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v1036620.2 Non Chatacterized Hit- tr|I1M2S4|I1M2S4_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,92.8,0,seg,NULL;
Glucan_synthase,Glycosyl transferase, family 48; SUBFAMILY NOT
NAMED,Callose synthase; LYS,CUFF.42074.2
         (1194 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP052274 homologue to UniRef100_A2Q2S3 Cluster: Glycosy...    64   2e-09

>gnl|LJGI|BP052274 homologue to UniRef100_A2Q2S3 Cluster: Glycosyl transferase, family
           48; n=1; Medicago truncatula|Rep: Glycosyl transferase,
           family 48 - Medicago truncatula (Barrel medic), partial
           (15%)
          Length = 563

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 591 ggcatggttcatgtcatatcaggagaccagcttcgtcactattggtcaaaggattctggc 650
           |||||||||||||||| |||||||||| || ||||| || |||||||||||  |  ||||
Sbjct: 80  ggcatggttcatgtcaaatcaggagacaagtttcgtgacaattggtcaaagattgttggc 139

                                                                       
Query: 651 taaccctctcagagtgcggttccactatggccatcctgatgtatttgacagggtttttca 710
           ||| || || |  || || ||||||||||| ||||| ||||| || || ||| |||||||
Sbjct: 140 taatcccctgaaggttcgtttccactatggtcatcccgatgtcttcgataggctttttca 199